Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4008
Length(NT) : 630
Best Gene Model Blast : Link to GSTUMT00008601001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: ref|XP_451421.1| Score: 739 E_value: 1e-76
KEGG Definition: unnamed protein product [EC:6.1.1.10]; K01874 methionyl-tRNA synthetase; K06878
Accession: kla:KLLA0A09647g Score: 739 E_value: 5e-77
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1247 Score: 842 E_value: 3e-91
PFAM Definition: tRNA-synt_1g, tRNA synthetases class I (M). This family includes methionyl tRNA synthetases..
Pfam Number: pfam09334 Score: 460 E_value: 6e-47
Swissprot: P00958|SYMC_YEAST
Gene Ontology:
GO:0017102 = Cellular component: methionyl glutamyl tRNA synthetase complex
GO:0004825 = Molecular function: methionine-tRNA ligase activity
GO:0005515 = Molecular function: protein binding
GO:0006431 = Biological process: methionyl-tRNA aminoacylation

Sequence:
>Contig4008
TTGGAGGTTATGTACGTTTGGTTTGATGCTTGCATTGGATACGTCTCTAT
TACTGCCAATTACACCAAGGAATGGGAGAAATGGTGGAAGAATAAGGACG
AAGTCAAGCTCTATCAGTTCATGGGCAAAGACAATGTTCCTTTCCACACT
GTTGTTTTCCCCGGAAGTGAAATTGGCACTCGAGAGGGAAACTGGACTAT
GTTGCATCATATCAGTACTACGGAGTATCTGCAATATGAGGGGGGCAAGT
TCTCTAAGAGCAGAGGGGTTGGTGTGTTTGGAAACAATGCGCGAGACACC
GGTGTTCCACCTAGTGTTTGGCGTTACTACCTTTTGTCCTCCCGCCCAGA
GACGGGAGATACACAGTTTGTTTGGCAAGATTTTGCTACCAAGAACAATT
CCGAGCTTCTAGCGAACCTCGGAAATTTTGTTAATCGTCTCATCAAGTTT
ATTAATGCTAAATATGCTGGGGTGGTTCCCGATTACACTATCGGGATCAA
TGATATATCCTTCGGTCAATATAAGGAATCAGTCAATGCGCTGCTGAAAT
CCTATATTGAGGAGCTCGAAAATGTTCATATCCGTGCTGGTCTTGAGAGG
GCTATGGCAATTTCCGGTGAAGGCAATAGG

Sequences in the Contig:

SY0AAC21YL06FM1 SY0AAC28YG08FM1 SY0AAD16YH20FM1