Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4007
Length(NT) : 658
Best Gene Model Blast : Link to GSTUMT00005333001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: hydroxyacylglutathione hydrolase, putative
Accession: gb|EDP52021.1| Score: 715 E_value: 7e-74
KEGG Definition: hydroxyacylglutathione hydrolase, putative [EC:3.1.2.6]; K01069 hydroxyacylglutathione hydrolase
Accession: afm:AFUA_5G12840 Score: 711 E_value: 1e-73
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0813 Score: 559 E_value: 2e-58
PFAM Definition: Lactamase_B, Metallo-beta-lactamase superfamily..
Pfam Number: pfam00753 Score: 201 E_value: 8e-17
Swissprot: Q99KB8|GLO2_MOUSE
Gene Ontology:
GO:0004416 = Molecular function: hydroxyacylglutathione hydrolase activity

Sequence:
>Contig4007
TTGGCAAATGTTTCACACTCTCTTCAACCCTCGACAGATATACTCAATTG
GCTCTATTATCACTAGAAAAATGCATATAAAATCTATTCCTATGTGGACG
GGAACCAGTGACAACTACTCTTACTTGATCATTGATGATAAGACAAAGGA
TGCTATGATTGTGGACCCTGCGCACCCCCCGGAGGTGCTCCCTGTCCTTG
GGAAGGAGATCTCCGAAAACGGGATTAACCTGAAAGCTATCATCAACACT
CACCATCATCGCGACCACGCTGGCGGCAACAATGGAATACTGGAAAAATA
TCCCCAACTTCAAGTACTGGGTGGAAAAGACTGTGAAGCAGTAACGCGCA
AGCTGGCAGACGGGGAAACCTTCAATATTGGCGAGGGAATAATGGTAAAG
TCGTTACACACGCCATGCCACACACAAGATAGTATCTGCTACTATGTGGA
GGATTCAGGGGATAAAGCGGCCTTCACGGGTGATACCTTATTTATAGCTG
GATGCGGGAGGTTCTTCGAAGGGACAGCAGAAGAGATGCACAAGGCACTC
AATACTACGCTCGGCTCGTTGCCAGATGACACGAAGGTTTACCCGGGGCA
TGAGTACACGAGATCCAATGTTCGCTTTGGGAAATCCGTCATTTGTTCAC
CGGCGATA

Sequences in the Contig:

SY0AAB35YA01FM1 SY0AAB51YO09FM1 SY0AAC21YK18FM1