Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4005
Length(NT) : 597
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 108 E_value: 4e-06
PFAM Definition: No Hit Found

Sequence:
>Contig4005
TTGGCCAGCTCTGAACGATAAAACCCGGCTGGCAACGGCGGTGAGGGGGG
CGAACAAACGATCAAACGAACGGATAAAAATATCTACAAACGTACTTACA
ACAAGCAATTACAAAGAAATAGCACAAGCGATGGCATTCAATCTCCGTTC
TTGGATACCCTGGTCCGGCCGCGGTTCTTCCTCCTCGGTACCTCCACCCC
CCTCCTCTTCATCACTCCCCACACCACCACCACTATCCCCCACCGTACAG
CCCCCTGCAGCCGCCACTCCAATCCCCGAACCAACCCGCCTCCGCCGCCA
GATAACCCTCCTCCTAGGCGGGACCACATTCCTAGCCCTCAGCATAGCAC
TAACCCGCCGCACAATCCACCGGCGCAAACTCTCGCTGGTGCCAAAATTC
TACCACCCGAACAACCGCCCACCCACCCACCCTCCGAACGGTGCCCTCGA
CGCCCTAGAAGCTTTGAACCTGGCAACGCTTAACACGCTGAGCTTTGGCA
TGATGCTGGTGGGCGGGGGGATGCTCGCGCTGGACGTGTGCTCGCTGGAG
GATTTGCGAGGAAGGGTGCACGAGGGGATGGGCGGGGAGGATGTAGC

Sequences in the Contig:

SY0AAA53YF20FM1 SY0AAC21YJ23FM1