Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4004
Length(NT) : 1154
Best Gene Model Blast : Link to GSTUMT00010746001 E-value : 0.0
Numbers of ESTs : 32

Blast Results:

Nr Definition: putative 3-phosphoserine phosphatase
Accession: gb|AAM03453.1| Score: 1104 E_value: 1e-118
KEGG Definition: predicted protein
Accession: aor:AO090009000301 Score: 719 E_value: 3e-74
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P53981|YNB0_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4004
TTGGATCTTCCCCGTCGTATTTATCATTTACTGCTACAAGTGCCGTTGAT
GCTAATGCAAGGAAACCAAACAAAGATATGCTTAGTTTGAAGGTTGCAAT
GCCTCCCCCTCGGGTGAATTCCCTCTACTCGAGTACACTATCCCCCACCC
CTTCAACATCTTCGGCCCTTGAGTCGTTCTCCACCTCTATATAACTAGGG
CCCTAGGACCCCTCCCTCTCTCTTCCCTTTCCCCTTCATCCTCATCCTCA
TCCTCATCTTTTTTTGCTACCCTTAAACTATTATACCATAAACTATAGAC
GGATAAATTTTCTGTTCAATCAAACATGGCCCCCGCAAACAAAGCTGTTG
TCTTTACCGATTTCGATGGAACCATTACTCTGAAAGACAGTAATGATTAC
TTGACCGACAACCTTGGATATGGGGAGCAGAAGCGTAGAGATGGCAACAT
TGATATCCTCGAGAACCGTGTCAAGTTTCGCGATGCATTCAAGGAAATGC
TCGACTCAGTACCCACCCCCTTCGACGAGTGTGTTGATATCCTCGTCAAG
AACATCAAGCTGGACCCGGGCTTCAAGGATTTCTACGCCTGGTGCTTGGC
TGAGGGGATTCCCGTCATCGTTCTTTCATCCGGAATGGAGCCCATTATTC
GCGCGCTCTTGACCAATCTTGTTGGACCAACAGCAGATCAGATTAAGATT
GTTAGCAATCAGCCCAAGCATTTGCCCGATGGGACATGGACCATCGATTA
TCATGATGACAGCGACTTTGGACACGATAAATCGTTGGCCATTAGGCCGA
CTGCCAACCTTCCAAAGGAGGATAGACCTGTTCTTTTCTACTGTGGTGAT
GGTGTATCCGATCTGTCTGCTGCGCGTGAGACTGATCTGCTTTTTGCCAA
GTATGGCCATGACTTGATCACCTACTGTGAGCGTGAGGGCAATCCCTTTG
TCGTCTTCAAGACATTCAGCGACATTCACAGAGATATCAAGGATATCATG
GAGAACAGGACCACCATTGATGAGGTGGCTGGTAGATATGGGAGGGAGAA
GGCGGCTGCAGCAGCAGCAACAGCAACATAAACTGTTCGGTAGATGAATG
CGTCTAGAGGATGAGGACTATCCATAGATAAATAAAGTATCTGTTTTTTG
TTTT

Sequences in the Contig:

SY0AAA13YD21FM1 SY0AAA18YG08RM1 SY0AAA22YD04FM1
SY0AAA28YP13FM1 SY0AAA30YP16RM1 SY0AAA42YL23FM1
SY0AAA57YC03FM1 SY0AAA57YC19FM1 SY0AAA6YA01FM1
SY0AAA8YH16FM1 SY0AAB15YJ02FM1 SY0AAB20YI16FM1
SY0AAB23YH20FM1 SY0AAB25YB02FM1 SY0AAB28YA06FM1
SY0AAB28YN23FM1 SY0AAB29YN11FM1 SY0AAB32YI18FM1
SY0AAB37YA18FM1 SY0AAB3YN24FM1 SY0AAB40YA09FM1
SY0AAB40YO23FM1 SY0AAB41YG19FM1 SY0AAB41YG24FM1
SY0AAB4YB20FM1 SY0AAB54YE21FM1 SY0AAB54YG09FM1
SY0AAB54YL16FM1 SY0AAB60YG23FM1 SY0AAB8YI13FM1
SY0AAC21YJ20FM1 SY0AAD21YD18FM1