Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4003
Length(NT) : 505
Best Gene Model Blast : Link to GSTUMT00009279001 E-value : 6e-80
Numbers of ESTs : 8

Blast Results:

Nr Definition: hypothetical protein FG06921.1
Accession: ref|XP_387097.1| Score: 211 E_value: 9e-16
KEGG Definition: hypothetical protein
Accession: fgr:FG06921.1 Score: 211 E_value: 5e-16
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0002 Score: 208 E_value: 7e-18
PFAM Definition: Ribosomal_L39, Ribosomal L39 protein..
Pfam Number: pfam00832 Score: 193 E_value: 4e-16
Swissprot: Q6BHV8|RL39_DEBHA

Sequence:
>Contig4003
TTGGCCACAACGAAATCCAACACGACGACAGAGCAAGAGACAACCGAAAA
GCATAGCCATGCCTAGCCAAAAATCCTTCCGCACCAAGCAAAAGCTTGGC
CAAAGCTCAGAAGCAAAACCGCCCAATTCCCCAGTGGATTCGTCTCCGAA
CCGGAAACACCATCCGGTACAACGCAAAGAGGAGACATTGGCGTAAGACT
AGGATCGGAATCTGAATCGACGATTTTGGCTTTTTCGCTTCTGTTCCTTC
CTTCTTCGGTTTCCTTTGAACCATCTCATCCTCTGGTTTCGGGATGGTGG
TGTAACAAAATTTATTGTTTTCTCTTTCAGCGGGTGGACTTGTGGGTAGA
AGTGTCAGGCAGGGTGGGGGTTTGTGAGAAATTTCGACCTGGTGGTGCGG
GGAGGGCTGGATTTCTTGGGATGGTGCCCGGAAGTATTTGAGGTCCTGTC
ACAAAAAGTCTGCTCGCGCGGCGGGAATAAAAATTAGTTTCTCTGAGAAA
AAAAA

Sequences in the Contig:

SY0AAB26YM03FM1 SY0AAB39YD03FM1 SY0AAC20YK24RM1
SY0AAC21YJ16FM1 SY0AAC21YJ16RM1 SY0AAC38YM15FM1
SY0AAD36YN22FM1 SY0AAD43YH08FM1