Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4002
Length(NT) : 1078
Best Gene Model Blast : Link to GSTUMT00004539001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein FG00954.1
Accession: ref|XP_381130.1| Score: 426 E_value: 5e-40
KEGG Definition: hypothetical protein
Accession: fgr:FG00954.1 Score: 426 E_value: 3e-40
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG1040 Score: 243 E_value: 2e-21
PFAM Definition: No Hit Found
Swissprot: Q4IPA4|YTH1_GIBZE

Sequence:
>Contig4002
TTGGGCCACAAAAATTTTCTGCTAAAGTAAACCCATAAGTTACATTGGAA
AATCCTACCCTCAAGCTCTCATCACCTTACCTAACGCCAAAACCAAGCCT
AACATCTCCATTTCTCCCTCCCCGGCCACCCATCCGACCGACCATGGCCA
CAGCGACAACTACGGCGGCAGCATCCCCGGACGCTTCGCTCGCCGAGAAG
ATCCTCAATCCCCAGTCCCAGCAGTTTGGAAACCGATTCGCATTTCACGA
GTTTCTGAGGAAGGAGTATAGGTTTGGTCTGGATCCTAATCGGAGGACTT
GTCCGCTGTTTGTGCAGGGACATTGTCCCATGGGGAACAGCTGTCCGGAT
AAACATGCGGTTTCAAGCTCCTTTAACAAGTAATGCTTTTTAGTCTTTCC
AAGGTTTTTTGTTTTTTTTCCACGCTGGGCTTGGGGGCGGTTGACGGAGG
AGGAGGAAGGAAGGAAGTGGGAAAGGGAAAGGGAAAGGAAATTTGCTAAC
GATGGTGGTAATGGAGTAGTTTAGTTTGCAAGCATTGGTTGAGGTCGCTA
TGCAAGAAAGGGGAGGCATGTGAGTTTCTTCATGAGTACAATTTGCAAGT
CCACTCCCTTCTCTTCGCCCCATTTCATTTTATGGTCATCCTTCGACTTT
CTTTCCTTTTTGATTGCTCCCCCCCGTAAACGAAGGCTAACGGTAGTGCA
ATAATGTGTGTCTTCCACTTTGATTCGTCCAAACAGACGCAAAATGCCCG
AATGCAATTTCTTCGTGCGAAATGGCTACTGCAGCAACGGAGAGGAATGT
CTATACTTACACGTAGACCCCGACAGTAAAATCCCTCCATGCCCACACTT
CGAGAACGGCTTCTGTCCACTAGGCCCCACGTGCTCCAAAAAACACGTCA
GGAAGCAGATCTGCAAGTTTTATCTGGCTGGCTTCTGTCCGGACGGCAGA
AGCAATTGCAAAGAGGGGACTCATCCAAAGTGGAAGACGGGGTTGCCGGC
GCCAACGGTAAAGAAGCCAAGAGAGGAGGTGGAGAAGGAACGTGATGGGG
ATAGAGAAGGCGGGGGTGAGGGGTCCAA

Sequences in the Contig:

SY0AAC21YH13FM1 SY0AAD25YD06FM1 SY0AAD2YP19FM1
SY0AAD39YG24FM1 SY0AAD42YE05FM1