Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4001
Length(NT) : 3336
Best Gene Model Blast : Link to GSTUMT00004203001 E-value : 0.0
Numbers of ESTs : 21

Blast Results:

Nr Definition: hypothetical protein SS1G_09029
Accession: ref|XP_001590265.1| Score: 2682 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ncr:NCU01193.1 Score: 2427 E_value: 0.0
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P22637|CHOD_BREST
Gene Ontology:
GO:0016995 = Molecular function: cholesterol oxidase activity

Sequence:
>Contig4001
TTGGGATGGGTGATCCGCTGGTCGGAGGGGGGGGTTTGCTGGCTGCTGGT
GGGTATTTGCTAGCATAAGGTGTTCTCTCGTTCGTCCATTTCTGAGTTCG
CCAATACACCCTGCTTCATCCATCTATCCAGCAACCTATATCAGACGGAC
CTAATTAATCAAACAAACCATGTCGCAATCCCCCGAGCGAACCCCTGCCG
TGCCGAATGGCCCCCAGCACCCTCCTCCCGCAGCTTCCCAGCAAACAGTC
TCGCTCCCCCACGAGATCCTCCAAGCCGACCCCGCAACCTTCGTCAAGGG
CGGCATTCCCCTCACCGAGAACGATTACGCCCAGTCCTCGGCCGACACCG
GTGCGGCTGAAGATGCTAAATTCCCGCGAATCTCGCGGCCTGTGCCGATG
ATGAGGGTTGAGTACGACGTCGTGGTTGTGGGCAGTGGGTATGGGGGTGC
CGTAGCTGCATCGCGAATGGCGAGGGCCGGGAAGAGCGTTTGTGTTCTTG
AACTCGGGAGGGAACGGTGGCCGGGCGAGTATCCCGTGGGATTGCTGGAG
GCGGCACCGGAAGTGCATGTCTCTGGGAACAGAGGGAAGAATGGGGAGCC
GGTTGTTGATGCTACCATTGGGGATCCGACTGGGTTGTATCATTTGGTGC
TTGGGGAGGGGCAGAATGCTTTTGTTGCTAATGGGCTCGGCGGGACTTCC
CTTATCAATGCCAACATCTTCCTGTCGGCGGACAAGCGTACCCTGCAACT
TCCGGCGTGGCCGCAGGAGATCTCTTCCAACCCGGCGTCTCTGGATACAT
ACTATACTCGTGCAGCTAGTGTTTTACAGCCGGTGCCCTATCCGGATGAC
TTTCCGCAACTCAAGAAGTTGAGTGTACTAGAAAAGCAGGCGGAATTAAT
GGGACAGAGGGAGCATTTTTACCGCGCACCCCAGACTACTGCTTTCACGA
ATGGTCCGAATAGTTCTGGTATTGAAATGCGTGCTTCAACCCTCTCCGGC
CAAGACTGCACTGGTGTCAATGATGGGAGTAAGGGAAGTGTGTTAATGAA
CTACCTCCCCGACGCCTGGAATTGGGGCGCAGAACTCTTCTGCGAATGCG
AAGTCCGCTACGTAAAACGCGACCCGAGCAATAATGCCTGGCTCGTCCTC
TTCGCCTGGCACGGCGACAAGCGCGCGAAGTTCGAAGACTTCCATAGGGA
ACTGATGTGGGTGAAAGCCCGAGAATTTGTCTTCCTCGGCGCCGGCACGC
TGGGCACGACAGAGATCCTTCTGCGCAGCCAGGACCATGGCTTAAAAACT
AGTTCTGAGATTGGCCGTGGAATGAGCGGTAATGGAGATATCCTCTCGTT
TGGGTATAATACCGATTTCGAAGTAAATTCTATCGGACGCGAAGATCCCG
GGAATCATCCCCCAATTGGACCGACGATTACGGGGGTTATTGATATGCGT
GATGCTATGCCGGATGTTTTGGATGGTTATGTTCTTGAAGAAGGAGCGGC
ACCGGAGGCGCTGTCGAAGCTGCTGCAGGGGATGTTGGAGCTTATGCCTG
GGAAGGTGTATCCAGAGAATTATGGACTTTCGGAGAAATTGCGGCATCTG
TTTTCCCGTGCTGAAGCGAGGTTGTTGGGACCGTATACTCCCGGTGGATC
GGTCAATCGTACACAAATCTACCTCATCATGTCTCATGATAGTAACGAGG
CGACGCTCACGCTTGAGAATGGAAAACCGTATTTGAGGTTCTTGGGGGTT
GGTCGCAGCGCGCATGTTAAAGAGTTGAACGAGATGTTGGCAAAGGCTAC
GTCGAAGATTGGAGGGACGTTGATCAATTCGCCGTTTTATTCACTGCTTG
GGGAGGAGGAGATTACGGTTCACCCTATCGGCGGAGCGAATATGTCTAGT
GATGGCACTGGGAGGAATGGTGCTACTAATCATTTTGGGGAGGTATTTAC
CGGCACAGGTGATGATGTACACCCGGGGCTTGTAGTTGTTGACGGGAGTA
TGATACCTTGTGCTCTTGGGGTCAATCCTTTTGCGACCATCACTGCTCTT
GCGGAGAGAAGTGTGGAAGGGGTGGCTGCAAAGCGACAGATCAGGATCGA
CTACGCCACTCGCAACACCCGTCTGAACCTCTTCGCACCCCCAATGCGTA
GTTTCCCGCTCACAAGGGATATGGCGGAAGCCCAACAGGCTATCTCCTCT
GCCGCTGGGAAGAGTGGAATCCGCTTTACGGAGGTAATGGAGGGATATAT
GTACATCGGCGACGACATCGAAGACTTCCAAGTCGCGGCCGACGCCGCTA
GGGGGTCTTCGACCTCCGCACGCTTCCTGCTTTCCGTCGATAGTTATAGC
ACTCAGAATCTTATTGAGCGATCTGATCATGCTGCACTTGCAACTGGAAC
CTTTGCGTGTGGAGCACTGAGTAGGGACCCGTTTATGGTTCTCCGTGGCG
AAGTGCAGTTCTTTTCCTTGGACTCTGATGTCGCTGATGGAAAGAACTTG
GCGTATAAACTTGACTTGGTCAGTTCGGATGGGAAGCTCTTGCATTTCAA
CGGGTATAAGGTGATAGACTCGAAGATGGCGTTCCCAGCTTCAAATACTT
GGAAGGCTACGACTACGCTCTATGTCACGCTGACTAGGCCGGATAAAACT
GTCGTAGCAAGGGGCGTACTAACTATCCCATGGAGGAATTTCGTGTCTGA
AATCTCTAGCTTCGGACAAACTGGAAGTACCGTCTCGGGAAGGATTGGCG
CCACGGTGGATTTTCTCGGCTACTTTGCTAGCCAGACGGCGGGGTACTTC
TTCAGCCCACTCAGACCGCTCCAGTACCCAACGCTCACGACGAGTGGGTA
TTATCGGAAGCAGCCACCGACCGAAATCGTGACCTTGACAGCACAGGACG
GGGTCCAGACGTTTATGCACGTCTACACTCCAGACCCTACATCGGGGCCA
CGCCAGAATAACCAAAACGGAGGAGGCGGCGGGCTACCACCGATCCTCAT
GATCCCAGGTGCAGCCGTAGACCACCGGATCTACGCCCTCCCCACGATTC
CTACCAACGCGGTGGACTACTTCCTCGCCCGCGGCCACACAATCTATATC
CCAACGCACCGCGTCGGCCGTACCCCATTGGCCAAGTCCTCACAAACCAC
CTTCTCCGCGTGCCTGGACGTAAAGGCCGCGCTGGAGCACATCCGTCGCG
AAACTCCCTCGCAAGTATACGTAATTGCACACTGCGCCGGTAGCATCGCC
CTCGGCTGCGGCCTCCTCGATGGGACGATTCCGGCGAGTTGGCTGAAGGG
CCTAACGGCCAGTCAGGTTTTCATCTCCCCACGCTT

Sequences in the Contig:

SY0AAA18YN07FM1 SY0AAA22YD17FM1 SY0AAA35YA24FM1
SY0AAA3YL08FM1 SY0AAB41YM13FM1 SY0AAC21YH07FM1
SY0AAC25YP19FM1 SY0AAC29YA02FM1 SY0AAC39YH15FM1
SY0AAC45YF09FM1 SY0AAC47YD06FM1 SY0AAC52YN18FM1
SY0AAD11YA18FM1 SY0AAD13YC12FM1 SY0AAD17YG02FM1
SY0AAD21YG12FM1 SY0AAD2YN17FM1 SY0AAD30YB08FM1
SY0AAD44YK19FM1 SY0AAD6YE02FM1 SY0AAD7YL15FM1