Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4000
Length(NT) : 607
Best Gene Model Blast : Link to GSTUMT00001781001 E-value : 1e-110
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN7055.2
Accession: ref|XP_664659.1| Score: 178 E_value: 1e-11
KEGG Definition: hypothetical protein
Accession: ani:AN7055.2 Score: 178 E_value: 5e-12
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4000
GTGAAGGCTGTTGGCCTCGGAAGGCCCTTTATGTACTCCAACGTGTTTGG
CAGGGAAGGTGTGCAGTACTTGATTGATCTCCTGAAGGAGGAGCTCACTG
TCGATGCCTCCAATTTGGGAGTTGCCGACTTGAAGCAATTGGATACCAAA
TGGTTGAACCTTGGCCGGCTACTCGCTTTCGTTTACAGACTAGATACAGC
ATAATAATAATGGTGATAACAATAACAATAATCATAATCATAATCGCAAA
TGAGGGACGCATACAATGCAGCATAGAATAGCAGAAATACACATGTTAGG
GCCTGTTCGGCATGTCACTTTTATTCCATAAAAGTGGTTTTTATGGCATA
AATTCCTCAAACTTCTATATTGAGGGGGTGCTCGACATGGCTAAAAAATA
TGCTACATTTTTATTGCATATTTCTCAATGACACAAGTTAGATGTTATTA
GATGGATGGTGACTACCACTGTGGGTAGCACAATGAGGGTTTCTCTATTA
AACTGGGATATTATCATATTAATCTCCCATGGGGCATCTATTATATCCTG
GTCATACCGACATTTATGTTTTCAGAAATAATATATTATGATTATGTTTT
TTTTATG

Sequences in the Contig:

SY0AAC15YC03FM1 SY0AAC21YG18RM1