Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig400
Length(NT) : 891
Best Gene Model Blast : Link to GSTUMT00011077001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SS1G_14439
Accession: ref|XP_001584670.1| Score: 383 E_value: 4e-35
KEGG Definition: hypothetical protein
Accession: ang:An02g08910 Score: 365 E_value: 2e-33
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG3798 Score: 213 E_value: 5e-18
PFAM Definition: No Hit Found
Swissprot: Q5RCU3|NAPEP_PONPY

Sequence:
>Contig400
TTGGATCATAATTGCAACCACAAATTTGTAGCCCCGTCACTTTTTCCGCC
AGCAAGCCCCACCCTTCCCCATCATAGCATGTCACGGGCCCCCTCTCTTG
GAAGGTGAAAGCTGGCGATTAGACAAGAGAGCGGGAGAGAGAGTGGAAGG
GAGAAAAAAATAAAATATATAAACGGGCTTATATGCGACCCCGTCCGGCT
TCAGATCTCTTCGGATTCCTGCAAAGTTCACATTCGTGCTTGCTGCAGAG
CTATCGCTTTGTTCCCAGGAGTTTGTTTTCACACAACCAAATCTACAGTA
ACAACGTCATACCACATTTCAGCACCGTCTCGTCTCGCACGACAACCCCC
ACGAGGATGTCCAGCACCAGGGCGGTTGTCGCCAGCGTCTATAGCGTTTC
CGTCTCTACACCGCAGAACCTCTCGAGCTCGCCGGAGGACGTGGCTAACA
AGTCCCACCACTTGGAGAATGGAAAAGGCTTTACAAATCCCTGGCCGAGT
TGGAGAGATTTAGATCCGATCAAGGCTCTGAAAACCATTGCTCGGCATCG
CGTGGGTCCTGACTCCGCTGGAATTTGGGGTCCCTCAACTACCCCACCAA
CAGTTCCAGTCGTAACCCCTCAATTCCTACCAGCCCGTTCCACTGTCTCT
ACTGAATTCCGTGCGACATGGCTCGGTCATGCTTGCTTTTATGTCGAGTT
TCCCGGTGGCTTCCGCGTCCTGTTTGATCCAGTATTTTCAGAGAGGTGTA
GTCCAGTACAATTTATCGGCCCAAAGAGATACACCAAGATGCCATGCGAT
ATTGCGGATATCCCTGTTGTGGACGCTGTGGTCATTAGTCATAATCATTA
TGACCACTTGGATCATAACACAGTTATAAAATTGAAGAAGC

Sequences in the Contig:

SY0AAA22YO14FM1 SY0AAA26YN10FM1 SY0AAA28YM01FM1
SY0AAA34YA20FM1 SY0AAA36YB20FM1 SY0AAA44YN20FM1
SY0AAA45YB06FM1 SY0AAA46YA14FM1 SY0AAA60YC12FM1