Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig40
Length(NT) : 2151
Best Gene Model Blast : Link to GSTUMT00005108001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001540992.1| Score: 675 E_value: 2e-68
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G04880 Score: 632 E_value: 8e-64
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig40
TTGGCCCGACCGGACCGTCACGAAGGGGATAGGATCCAGGGATAAAAATA
AAACTCTCTATCACAACGGGAGAAGGAAGGTAGCTTCTCAAGCGCCTTTA
AACGACGAAGAAACGGTTGATTAGAAATAAGTCGGGTTAGAATAAATCCG
GCTGGGGCTACGACGACTTCGCTTTGAAGCCGTCAAAATTCCCTACGACA
GCAGCAGAAATTCCCTCCTCGGAGGTGGACTAATACCCCAGATGCGATCA
AGGATGTTTTACCGACCGACCTCAACGTGGAGCTGGAGTTTCCTCCTTCT
CGCAATCGTTCAATCATGTGTTGTGTTGGGTCTTGAAGGTTTTGTATTCG
CTGCATTCCAGAACAACCTGCATCAGGACTTTATCAACAAATCAAAGAAC
GAGTTTACGAAAGCACAAACACGAACTATCCCGACATATCTGACCCTCTT
CATCTTTGGGCACATTTTCCTTGTCGTTCTTTGCTACGATGCACTTAGAT
TGAAGAACACCATTCAGATCATTGGAATTTGCATCTTCAATGCTGCGTTG
CTTCTCTACGCTGCTATCCAGATGGATCAGATTCACGATGCCAATACTTT
CTTGACCGTTCTTGGCGTTGGACCCGACCCGAACGCTGTGGGTATTAAGG
AGAATATCTGGCCAGTGATTCAACCGTCTTTGATTGCGATTCCATGCGTG
ATCGCCTTGTCAACCGTGTTGATGTGCGTCATTTGTTGGAAGTTGTATGA
CGAGTTCGCTTGGACCATCTACAAGCATATCAGTGCAGATTTAAAAATGA
AGGAGAGATATCTCAAGTTCCAGATCTTCATTGCTCTTCTCAAGTTTGAT
TTCTTCTTCTTCGTTGGATTCACTGTCCAGTTCATCGTCATTGTCGCCTC
TACATCGAACTATCTCAAAGGGGGGGGCTCTAAACTTGGAAATACTGACA
AAGACTATGAATTCTTCCTCACCATTGCTGTCCTACCCCTGACCATCGCT
TTCTTGGTTCTCGCCGCTTGGTGCACAAGGAGAGAGAAGAAGATCCCTAT
GGTGTTCATCATTATTATCTTCTTTGCCGCATTGGCTTACTTCATCTTCA
AATTGGTCAGGATGTACCATGGCAGTTTTGTCGAAAGCTACAAGCCGGCA
AAAAGGAGTTTGACCACTTTTGCTGCGATCACACTCATTCTTATCATTTT
GACCATTGCAAACGCTATCGCTTGCGTTATGAACTTCGACAAGGGCCTGA
AACCCCACATCACCCGAAGGAAGATGACCGACGAGGAGGAGAAGCACAGC
ATGACCGAAATGACGAATCAAGCTGCTCAGCCGATACCATCCCGAATGAC
AATTGACTAAAAACCTGACTTCAACCCCGATAACAGCCTTATGCTTTGCA
CCTGTCTTTGTCAACCTCTTGGGATAGGAAGGCGGTTTTATCTTCCGCGC
CAGTCCGTTATTTTGTTTCTACCGAGTGATCTAGCAAATCGTGGATCCTG
GATCTCTTATCTTAATTAATTTATGGGCTTGCGCATCGTTTTGATGCCTT
TTGTAGAGAAAAAAAATTGGTGTATCTGAGCAGCGTTTTTCTTCTAAATT
TTCTCATTGCTATTCTACGGGGGTCACTTTTTTGCATGAATAATTTTTCA
CATGGTGTTTTTCTTTTTTTTTCTTTTTACTCATGTGCTACTCTTCTGGG
ATACCCTCAAATTTGCGAAATGGAGTTACTTTCAGGGATGCAACGAGACT
TTGGAAGGACAAGGGGGGATGGTTACGAGGAGAGCGCATACGGTATCATA
GGAGGGGGAAACCAAGGAAGGGGGAGGGATGGCATGCATGCAGGCAGTTG
CGATTGCGCGGGGTGTGGTGTGGTGTGATGGGGTTGGAAAGGAAAAATCC
TCCAAAATTTCGGTGGGGCTTAGTCTAAACCACGCGTCCATTAAGCCATC
GATTTAACTTGCGGGAAAAGCGATTTGAAAGGAAGGACAGAAGTGAACAA
TGGTCCCCTTGCGGAGTAAATACCTACTGGTGGTTTGGAGGTCTTGGGGG
GGTTTTGATTCTTGAGAAATTTATTCCTTTTTACTTTCTTTATCTTATTT
TATTGCCCTTTCCTTCTCACGGGAAAAACCTTTTTCTTTCCAAAGTATGG
A

Sequences in the Contig:

SY0AAA11YH18FM1 SY0AAA26YL18FM1 SY0AAA26YL18RM1
SY0AAA30YI18FM1 SY0AAA41YG05FM1 SY0AAA5YB19FM1
SY0AAB14YM14FM1 SY0AAC12YM11FM1 SY0AAD59YM14FM1
SY0AAD8YG18FM1