Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4
Length(NT) : 837
Best Gene Model Blast : Link to GSTUMT00000269001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: histone H2A
Accession: ref|XP_001541426.1| Score: 421 E_value: 1e-39
KEGG Definition: httA; histone H2A httA-Aspergillus niger
Accession: ang:An11g11300 Score: 420 E_value: 9e-40
KOG Definition:
Classification: [Chromatin structure and dynamics].
Kog Number: KOG1756 Score: 541 E_value: 4e-56
PFAM Definition: Histone, Core histone H2A/H2B/H3/H4..
Pfam Number: pfam00125 Score: 239 E_value: 5e-21
Swissprot: Q875B8|H2A_PODAN

Sequence:
>Contig4
TTGGGTTTTTCCTTCCCCTAGCAACCAACCCACCAACCACCCAAACTCTA
CCCCTACACCCCCCCCTGCCACTAACTGAGTGTGATGCAACCTGCCTCAA
CCCAGCGGTATAAAGCCCACTCCATCGCCCACATCTCCCTTTCCCTCTCC
CTCCCTCGTCCATCCGTTCTTCAACCTCACCACAACGCTCATCAACTCAC
AGCTGCGTCTACTTTCAACGCGTAATTTCGCCCACCTCCACTTTTCAAAA
ACCTTTTCGAAAACCCAACTCTTACGCCAAAGATGTCTTCCGGAGGCAAA
GGTGGAAAAGCTGCCAGTGGCAAGCCTTCTCAGAGCCGTTCTTCTAAGGC
CGGTCTCGCTTTCCCCGTCGGTCGTGTTCATCGTCTTTTGAGGAAGGGAA
ACTATGCTCAACGTGTCGGTGCCGGCGCTCCTGTCTATCTCGCTGCCGTT
CTTGAGTACCTTGCTGCCGAAATCCTCGAGTTGGCTGGTAATGCTGCCCG
TGATAACAAGAAGACTCGTATCATTCCTCGTCATCTTCAGCTTGCCATTC
GCAATGATGAGGAATTGAACAAGCTTCTTGGCCACGTCACTATCGCCCAA
GGTGGTGTCTTGCCTAACATTCACCAAAACCTTCTCCCCAAGAAGTCTGG
AAAGGGTGGTGCCAAGGGCGCCTCTCAGGAGTTGTAAACTTCTTCCTTTT
TCGATTTCAAATAAATAAAAATAATTCTGCGCAAATCAACGCGTTTTGTC
TGGCTTCTTTGATCGGTCCGGGTGTGATTTTTTTGTGTGGAAATGTGAAA
AAGATCCGAGGATGAGGGATACAGGAGATGGGACGAC

Sequences in the Contig:

SY0AAA10YB08FM1 SY0AAA30YF07FM1 SY0AAA35YF11FM1
SY0AAA55YB07FM1 SY0AAB15YE12FM1 SY0AAB22YI22FM1
SY0AAB23YL05FM1 SY0AAB27YN04FM1 SY0AAB28YH24FM1
SY0AAB39YH19FM1 SY0AAB42YB08FM1 SY0AAB45YD22FM1
SY0AAB47YI10FM1 SY0AAB47YM20FM1 SY0AAB61YH11FM1
SY0AAD21YP15FM1 SY0AAD55YL09FM1