Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3999
Length(NT) : 740
Best Gene Model Blast : Link to GSTUMT00001781001 E-value : 1e-129
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein MGG_09162
Accession: ref|XP_364317.1| Score: 211 E_value: 2e-15
KEGG Definition: hypothetical protein
Accession: mgr:MGCH7_ch7g962 Score: 211 E_value: 1e-15
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0538 Score: 158 E_value: 9e-12
PFAM Definition: FMN_dh, FMN-dependent dehydrogenase..
Pfam Number: pfam01070 Score: 178 E_value: 5e-14
Swissprot: P05414|GOX_SPIOL
Gene Ontology:
GO:0003973 = Molecular function: (S)-2-hydroxy-acid oxidase activity

Sequence:
>Contig3999
TTGGGCTCCACTTTTGCCCCAGCGCACTGTTCGAAGGATCTTTCTGCAAA
GGCAATTCACCCATTCAGGATGCGTGCCGCTATTCTTTTCTTTCTCTTCT
CCGCTTCGGCGCCTGGTGCCTTTGCTGTTACTCCCTTCCTAAATGAGCCT
GATACTGGATTCAATGATGGAGCTGTTCCCACTGGACAGCTTCCTACCTT
GAACAGTATCAAGGCAATTCCTGATTTTGAGGCGGTTGCTCGTCACTTTA
TGAATGTCTCGGATTATGCTTACTACAGAACTGGCGCTGCTGGGGAATTT
GGTATGCATTTCTTTACAACTATGATACTATAAAAACTTGAATAATTGGA
CGGTGTGCTACCGGTACGCCGTTGGGCTTTCCTCCCTCAGTAAGATCTGT
CTCGCAAGGGGAAAGGGACAGTGTTTCTACTGTGTTTTTTGCCCCTTTCT
AGAGAAGGGAATTTTGTACTAGGTAGCGCACTATCCAATTATTCAAAGTT
TTTATGGTATTAAGACTTGTAGACGGGCGCAATGTTAACAAGTTTCCAGC
GTATCGACGCTCGCTGGAGATCTTTAGCCAAGTCAAGCTTCGTCCCCGAA
CTCTTATTGATGTTACCAATATTTCGCTCAACACAACAATTTTCGGGCAC
AAATTCACTGCACCATTCTTCATTGCTCCCGCGGCCCGTGCAGGTCTCAC
CCACCCTCGGGCTGAGCTCAACCTTGCCGAAGCGGCTGGT

Sequences in the Contig:

SY0AAC13YN02FM1 SY0AAC21YG18FM1 SY0AAC30YA07FM1
SY0AAD26YF09FM1 SY0AAD42YB23FM1