Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3998
Length(NT) : 650
Best Gene Model Blast : Link to GSTUMT00002666001 E-value : 1e-163
Numbers of ESTs : 2

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001263800.1| Score: 138 E_value: 5e-07
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3998
TTGGCATAGAGGCATTGTATATACAAGCATCCGAGCCCTTTATTAATTTG
TGCCAAGCAATGACCACTTCATTTCCCTTTCGTGTGTCTGATTCTCTCCA
ACTCCAGGACGTTCCTTTCCCACTCCTCCATGCTGCCATCTGGTTCTAAG
GTTTTGTCTGCTCCAAGCCTGAACCACCCACCCCCGCTTGACGCTGCATG
AATCTTCTTATCCTTCATGAGCTCCAACATGTTGGCCACATTCCTTCCAG
TCACAATCGCACATTCTTTACAGGCCCCTCTCAACCCTGCTAGTGCCCTG
CTCTTTCTGTAAGACTCCTTAGTCCAGGCAAGACCTTGTTGCTGATCACC
CATAGCAAACAGCAACTCTCCGATATATGCCATGGTAACAGCTTCGGCAC
AAGGATCTGATATCTCCTTCGAAGACTCAGATTTTGCGGGGTTCTCCACC
GGTGAGGCAGTACGACGTGCTTGCAATATGGTGGTCAGCAACTCTAGTGC
AAGATGCTGGCGGTCATTACGGGCGTGTAATATAGAGAGCTCGGTGATTG
CTTTTAACAGCAACGGCGTATTCTCTTTTGAGGATGGGTCAGGAAGCGGG
GGTAACCCGTTCGAGGTTCGGTTTACGTCATTGGAGTCTGTGGGGGCGGC

Sequences in the Contig:

SY0AAC21YG04FM1 SY0AAC35YI10FM1