Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3997
Length(NT) : 1251
Best Gene Model Blast : Link to GSTUMT00006755001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3997
TTGGCAGTAAATAAATTTAACTGGTGCTCGGAAGAACAACAAAGATCTGA
AGCTTTTTGTTGTGGTGGGCGCGTCTTGGCGTTGAGGTGTGTTCGGATAC
TGCTGTGTGAGCTTCCAGAGTATGATGACCTCGAGTTTTGGCACCGTGGG
TACCTCGTAGTTGTGGAGAGAGGTATTTAAATTTAATGTGATGGAGGTTT
AAAAGAAAATTTTTTTTTTTTTTTTTTTTTTGCACTTTTCTCGTTAATTG
TCTTTTTCATCGTCGTCCTCCTCCTCGTTCGTCGCCTCACTGTTGTGTTG
TATCATAGTTCTAGCTTGCTTGCTTGCTTTGCTGAGGACATTTCGAGCCT
CTATTTTCTATTTCTGCTTTTACTGTCATATCTTTTTGAATTTGGTTCGA
TCTGACTCGGTTTCGTGGGAAAAAAGGAGGAAGGAACGACAAAACAAAAA
AAAAAAATTTTAGGAAAAAGAAAAAAAAATTTAGAAAGAAACCTCGAGGG
TTGGTGATGAATTCGTTACCCATCGAACTTACCGACCAGATCATCTCCCT
ACTGCCGAAGAAGAGCCAGTTGTCGGTTCGTCTGGTCAATCGACGGCTCT
GCGAACTAGCCACAGCTTCCGTGTTTCGGGAGGTCACCACTTACTTTTGC
AAGGAGAGTTTGAACAGATTGGAGAACATCGCCTCGACGCCAAGGTTAGC
GAGACATGTTAGGAGTTTCGAGTATGCATTTGTAGGTGTTTACAGTACTC
TCATGTCCTTCGTGCATTTCAAGACCATGCTGGCCCCACCTGGCCGGGCC
TACCACGGGGAGCACATGAAGACCTTCTACACGCACTACAAGGAGCAGTT
CACGGAGCACAGTTCCCTCCTCCCGCTGGAGCCGCGGATACTCCGCCGGG
CGATGTGCGCCTTCCCGCACTTGCGGTGCGCTACGCTACGGTACGGGAAG
TATGACCACGCATATAACGACGAGAGCTGGTCCTACACACTCAAGAACGT
CCCGCTCGGTGGGAAACGCGCGCATAAAGCCCTCACCGAAGCCCTCGCAA
AGAGGGCGGAGACCGGGGGCGGGGGCGGGGGCGGGGGGGATGTCATGCCC
TTGGAAAAGTTGTCGGCTACGGGGATCCCGCAGATGCCATTTGATGAGCT
GTTGAGCTTTGGCCGCCGCGGCGTCGGTGATGGGGGGCTGGTCGAGATGC
TCACGACGGTAAACATTCACATCGCGCGACAGAAGAAAGAGGCATACCCA
A

Sequences in the Contig:

SY0AAA40YE20FM1 SY0AAB21YI10FM1 SY0AAB61YN16FM1
SY0AAC13YE16FM1 SY0AAC21YF19FM1 SY0AAC28YI04FM1
SY0AAC44YN07FM1 SY0AAC45YG19FM1 SY0AAC53YB24FM1
SY0AAC58YB15FM1 SY0AAD18YN10FM1 SY0AAD29YK08FM1