Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3996
Length(NT) : 1434
Best Gene Model Blast : Link to GSTUMT00011446001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: casein kinase II beta subunit
Accession: ref|XP_001558441.1| Score: 961 E_value: 1e-102
KEGG Definition: hypothetical protein
Accession: ncr:NCU02754.1 Score: 950 E_value: 1e-101
KOG Definition:
Classification: [Signal transduction mechanisms, Cell cycle control, cell division, chromosome partitioning, Transcription].
Kog Number: KOG3092 Score: 772 E_value: 1e-82
PFAM Definition: CK_II_beta, Casein kinase II regulatory subunit..
Pfam Number: pfam01214 Score: 690 E_value: 4e-73
Swissprot: Q8TG11|CSK2C_NEUCR

Sequence:
>Contig3996
TTGGCGGTTCTACTTACGCTGAGATATACACGAATGACCTCAACTCTTCT
AGTAAGATTTCATAACTTGGTTGTAGGGTATCAGGGAGTTCTGGCAAAAG
CCTAAGTCCAGATTCGTTACATATCTTTTCACCAACAGAAAACAACACGA
CCCTTAACACTGTTCGCGTCACCTCTGTCCTTTATCACCATCGTCTCCAA
CCAACCAACCTCACTCAACTTTGTCCTGGTACGGTTGACAGAACCCGTCC
TGTACATAGTCAAGCCTTGTGGGTGTTTTTACGAAATCCAACGGTCCCGC
ACCGGAGCATCTCTTTTGGGAAGCAACAGGAGTCTAGTCCGACAAGCTCA
ACGATCTTCCCCGACTTAGAAAAGGATCTCTCCGAGGGGTCTAGAAGGCT
AAAGAAACTATCATCATGGAAGATTTTAATTCGGAAACGGATAGTGACTA
TGCCAGCTACTGGCGAGATTGGTTCATCTCTACGCGCGGCCATGAATATT
TTTGCGAAATCGACGAGGAATACCTGACTGATCGCTTCAACTTGACTGGA
CTGCAATCAGAAGTGCAATACTATCAGTATGCATTGGACCTGGTCACTGA
CCAATTCGATTTTGAGTGTGAAGACGATATGAGAGAGCAGATTGAGAAGT
CAGCTAGACACCTTTATGGCTTGGTTCATGCGAGATATATCATCACAACG
CGTGGACTCGCCAAGATGTTGGAGAAGTACAAAAAGTGCGATTTTGGCCG
TTGCCCCAGAGTTCTCTGTCGCTCACACCCTCTGCTGCCATTGGGCCTCT
CAGACTTGCCCCACCAAAAGCCCGTCAAACTTTATTGTGCGAAATGCGAG
GACGTATACTCTCCAAAGTCCTCTCGTCACGGAGCGATTGATGGTGCCTA
TTTTGGAGCATCATTTCCACATATCCTTTTCCAAGTTTACCCAGGATTAA
TCCCTCCCAAGAGCAATGAGCGTTATACACCAAGGTGTTTTGGGTTCAAA
ACGCATGCTCAAGCTGCCTTAAGCAGGTGGCAGGAAGGGGAGCGAGAAGC
TCAGGACGCTCGACTTGAGAAGGCTGGGGTTGAGGTGAGGAGGGTTGATG
GGGAGGAGGACGAGGACGAGGATGAAGAGGTGGCGGAGGCATAACTCGAT
CTAGAAGCGTGGATGGAGTTATAGTGTTATCGATGGAAAGAGGCATTGCC
CATTCGTTGGGGAAAGGTGTTAGCTAGTTGCGTTTTTCAATTTTCAACTG
CTTGCTTCCGTGGGTCCTGTATGTTGGGGGGCGTTTCTTTGGGTTCATAT
CATTCGTCTACTAAACACTTTCAGATACCGGCGTATTACGTCCAGGGTAC
GATTGTATCATTTTAAGGCTTGCTAGATTCTTTCGCCGGCTATAAAGGGC
TTATCAATACCATGACACAAATTACCAGACACAT

Sequences in the Contig:

SY0AAA11YP05FM1 SY0AAA25YI18FM1 SY0AAA37YD05FM1
SY0AAA45YC04FM1 SY0AAA52YA10FM1 SY0AAA5YP23FM1
SY0AAB39YD19FM1 SY0AAB57YA20FM1 SY0AAC18YL23FM1
SY0AAC21YF10FM1 SY0AAC21YF10RM1 SY0AAC25YI03FM1
SY0AAC45YC16FM1 SY0AAD22YC06FM1 SY0AAD26YO10FM1
SY0AAD43YN23FM1