Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3995
Length(NT) : 526
Best Gene Model Blast : Link to GSTUMT00000778001 E-value : 9e-76
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein An12g01510
Accession: ref|XP_001395238.1| Score: 247 E_value: 1e-32
KEGG Definition: hypothetical protein
Accession: ang:An12g01510 Score: 247 E_value: 5e-33
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1493 Score: 222 E_value: 2e-19
PFAM Definition: No Hit Found
Swissprot: Q9UT86|APC11_SCHPO
Gene Ontology:
GO:0005680 = Cellular component: anaphase-promoting complex
GO:0005515 = Molecular function: protein binding
GO:0031145 = Biological process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process
GO:0008054 = Biological process: cyclin catabolic process
GO:0007091 = Biological process: mitotic metaphase/anaphase transition
GO:0016567 = Biological process: protein ubiquitination

Sequence:
>Contig3995
TTGGCAACTGAACCCCGCCCTACCAACCAACCAACTCACACGTTATCCAT
CCATCCATCCCACTCCACAAACATCACACCCCGAGCAAGCACGTGTGACG
GAGCCATGAAGGTCAGAATAAGGAAATGGAACGCGGTAGCCAGCTGGCGT
TGGGATGTCCCTGAAGATGACGTCTGCGGAATCTGTCGCGTCCAGTTCGA
CGGAACATGTCCGAATTGCCGATTTCCCGGAGACGATTGTCCACTACGTT
GTTTATCTTTTCTTTTCTTTCCTCCTTACTACCGGTATTTAAGCTAACTA
ATAGGAAAAACTTCTAGTGGTCGGGAAATGCGGACATTCATTTCACTTGC
ACTGCGTAAACGACTGGATCCAGACGGAAAGCTCGAGAGGCCTCTGTCCC
ATGTGCCGGCAGAAATTTGAATTCGTCGCCGAGTAATGGCTACATAAGAT
GAGCGTATAAGGGTTGATTGAGTCGTGCCAAATCAAGCCAAGTGAGGTCA
GGCCGGGGGGGGGAGGCGTTCTGGTC

Sequences in the Contig:

SY0AAC21YF08FM1 SY0AAC27YO09FM1 SY0AAC35YJ05FM1