Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3994
Length(NT) : 2014
Best Gene Model Blast : Link to GSTUMT00007078001 E-value : 0.0
Numbers of ESTs : 29

Blast Results:

Nr Definition: hexose transporter
Accession: gb|AAY26391.1| Score: 2253 E_value: 0.0
KEGG Definition: MFS monosaccharide transporter, putative
Accession: afm:AFUA_2G14590 Score: 1642 E_value: 0.0
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0254 Score: 1075 E_value: 1e-117
PFAM Definition: Sugar_tr, Sugar (and other) transporter..
Pfam Number: pfam00083 Score: 1139 E_value: 1e-125
Swissprot: Q92253|RCO3_NEUCR

Sequence:
>Contig3994
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGCACAGGTTGAGAGGGAATTCCCTGGGGATCTAATTTTCCAAC
AATCTCACTTTTCCTACTTCAACGTTCAAGTCAATTCAACTCAAGTATCA
GCAATGGGTTTCCTAATCAAGAAACCAGAGAACGAGGCCGGCAAGGCTGT
GCCTGCTATTGTCATTGGTGTCTTCGTCGCCTTTGGTGGTATCCTTTTCG
GATATGATACTGGTACCATCAATGGTATCCTCGCCATGGACTACTTCCAG
GCCGAGTTCGCTACAGAGAAGAACGATCAGGGTGTATTGGCACTGACCTC
GAGTCAAACCTCGTTAATTGTCTCTATCTTATCCGCTGGTACCTTCTTTG
GAGCTCTCACTGCCTCTCCCTTCGGTGACATCTTGGGTCGTCGTATGGGC
CTTATTGCTTCTTGCGTGATCTTCTCCATCGGTGTTGCCTTCCAGGTCGC
TTCCACCACCATTCCTCTGATGGCCGCCGGTCGTGTTGTCGCTGGTTTCG
GTGTCGGTCTAGTTTCCGCACTAGTACCTTTATACCAATCTGAGTCAGCG
CCAAAGTGGATCCGAGGAACCATCGTCGGTTGTTACCAATTGGCCATCAC
CATTGGTCTCCTCCTCGCCGCTTGCGCCAACCAGGGAACTCACGCCCGCA
ATGATGCCAGTTCCTACCGTATCCCACTAGCCATTCAGTTCATCTGGGCT
GCCATCTTGGCCGGCGGCATGTACATCCTTCCGGAGACTCCCCGCTACTA
TATCAAGAAGGACAACATGCAGGCTGCTGCAAAGAGTATGAGTCGTCTCC
GCTCTCTCCCAACCGACCACCCTGCCATCGTCGAGGAGTTGAACGAAATC
AAGGCTATCCACGACTACGAGATGTCATTGGGTGTCGGAAATGCTACTTA
TGCAGACTGCTTGAAGCCCGACATGATCAAGAGATTGTTGACCGGATGCG
GACTTCAGGCCCTCCAGCAATTGACCGGTATCAACTTCATCTTCTATTAC
GGAACTCAATTCTTCAAGAACTCTGGTATCCAGAACGCTTTCCTGATCGG
TCTCATCACTAACTTGGTCAATGTCATCTCCACCTTTCCCGGTCTTTGGA
TGGTTGAGAAAATGGGTCGTCGCAATCTCCTTCTCTTCGGCGCCGTCGGT
ATGTGCCTCTGCCAATTCATTGTCGCAATCGTGGGTGTTACCTCTTTCAC
CGCCGTCGCAAACAATGTCCTCATCGCGTTCGTCTGCTTCTACATCTTCT
TCTTCGCCTGCTCTTGGGGTCCTTGCACCTGGGTCGTTACCGGTGAGATC
TATCCCCTTAAGGTCCGTGCCAAATGTCTTTCCATTTCCACCGCAACCAA
TTGGCTTCTCAACTGGGCTATCGGTTTCTCAACCCCTTACCTTGTCGCCA
AAGGCAAAGGCAACGCCAACCTTGGACTCAATATCTTCTTCATCTGGGGT
GGATGCTGCTTCATCTGCATTGCTTTCGTCTACTTCTTCATCTACGAGAC
CAAGGGACTCTCTCTCGAGGACGTCGACCAGCTCTACATGACTGTCGACA
AGGCATGGCACTCCCAGGGGTTCGTTCCATCAATTACTTACAGCCACGAA
AAAATGCATGCCACCGGAAACGGCTCTGATGGAAAGGCCGGGCTTGCTCA
CATTGAGGGCAGTCACGGCGAGGTTTAAAGAATTATAAATTTTTGTTTTT
TGTTTCTTGTTTTCCAGTTTCCTTTTTGTACGTTTTTTTTTTTTTTTTTT
TTTGTTTCCCCGCTTAATCCATGAGCGAGCGGGTGCGTTCCGTAGAGGAC
GTGCATGTCGGAAGATAGGGGAAGGGATCTGTTTCTTATTGTTTACTCTC
TCGCTCTGCGCTACGATTATCGGAGGTGTAAAATGATATAAGGTAACATC
AACGGATAAAAAATGTAATTATGCCTAGATCAAATATACCTTTTCGAACC
AGGGATTGCTTTCC

Sequences in the Contig:

SY0AAA50YL22FM1 SY0AAB36YF05FM1 SY0AAC10YK15FM1
SY0AAC17YP05RM1 SY0AAC21YE16FM1 SY0AAC22YI23FM1
SY0AAC22YO01FM1 SY0AAC25YG23FM1 SY0AAC25YG23RM1
SY0AAC26YH08FM1 SY0AAC33YP14FM1 SY0AAC35YD22FM1
SY0AAC50YE18FM1 SY0AAC52YC16FM1 SY0AAC59YD16FM1
SY0AAD1YF02FM1 SY0AAD21YM11FM1 SY0AAD27YB16FM1
SY0AAD31YG10FM1 SY0AAD31YH01FM1 SY0AAD40YI24FM1
SY0AAD48YB09FM1 SY0AAD48YI09FM1 SY0AAD48YO21FM1
SY0AAD51YK12FM1 SY0AAD59YL06FM1 SY0AAD59YO09FM1
SY0AAD61YM07FM1 SY0AAD9YB08FM1