Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3993
Length(NT) : 651
Best Gene Model Blast : Link to GSTUMT00002338001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: acetyl-coenzyme A synthetase FacA
Accession: gb|EDP50475.1| Score: 399 E_value: 3e-37
KEGG Definition: acetyl-coenzyme A synthetase FacA [EC:6.2.1.1]; K01895 acetyl-CoA synthetase
Accession: afm:AFUA_4G11080 Score: 399 E_value: 1e-37
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1175 Score: 395 E_value: 3e-39
PFAM Definition: No Hit Found
Swissprot: P16928|ACSA_EMENI

Sequence:
>Contig3993
GTGAGAAAGAGAGAGAGCCTATATTGGATGGAATATGGCAATACAGAACC
AGGAACCCGAACGGTATGAAAGGAAAATAATGAGAAGAAAAGGTCCTAGA
CAAAAAGGTATGATATGATAGATTTCCGTCTCTCGGAACAGGCACCCCCT
CCCCCGACTTTGTCACAGGGTGGATGTTTATTTTTAATTTTTCCTCTTTT
TTGACCTTTGGAAAAGGAAGGAAAGGACCCGTATCACACCCTAAACCCTT
CATCTACTTGTTTCCAGTCTCGTGCAGTGTCTCAAGTATGGTACCAACGA
CAGAAGGGTCCGACAAGGTCGAGGTATCACCCAACTGATCCTCTTCGCCG
GATAGGATCTTTCGGAGGACGCGTCTCATAATCTTTCCCGATCTAGTCTT
AGGAAGGTCATTGACCACGTGCACCGCCTTGGGGGCTGCGAACGGTCCAA
TGGATTTCCGGACTTGAAGGGTCAAACTCTTCCTCATCTCAGAAGAGTTC
TCGAAGCTGTCCTTTAGCGAGACGAAGGCGTTGACAGTCTGGCCAGTCAA
CTCATCGGCAATACCGACTACAGCAGCCTCGGCAACAGCCTCATGATGAA
TGAGGGCGGCCTCGATCTCTGCGGTTGACAACCTGTGACCGCTAACGCCA
A

Sequences in the Contig:

SY0AAA18YC17RM1 SY0AAB53YC03FM1 SY0AAB8YP17FM1
SY0AAC17YD08RM1 SY0AAC17YL02RM1 SY0AAC20YM20RM1
SY0AAC21YD08RM1 SY0AAC26YI15RM1 SY0AAC31YJ12FM1
SY0AAC32YN06RM1 SY0AAC7YN10FM1