Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3992
Length(NT) : 1204
Best Gene Model Blast : Link to GSTUMT00009721001 E-value : 0.0
Numbers of ESTs : 9

Blast Results:

Nr Definition: hypothetical protein SNOG_12153
Accession: ref|XP_001802384.1| Score: 352 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: ang:An01g08310 Score: 333 E_value: 2e-29
KOG Definition:
Classification: [Chromatin structure and dynamics, Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0996 Score: 145 E_value: 5e-10
PFAM Definition: ERM, Ezrin/radixin/moesin family. This family of proteins contain a band 4.1 domain (pfam00373), at their amino terminus. This family represents the rest of these proteins..
Pfam Number: pfam00769 Score: 130 E_value: 3e-08
Swissprot: P53253|NNF2_YEAST
Gene Ontology:
GO:0005624 = Cellular component: membrane fraction

Sequence:
>Contig3992
TTGGATCGATATCACTGGTCTGACTGGAGCAACCGAGTACGATTTTGAGT
TCGTCAAGAAGGGTGGGAAGATAGTCTACCAGGCAAGTGCATGCACAATG
CCTGCTCGAGGTATGTTTTACCCTAGATTAATTGAAGGGATTCGAGTCTA
ATACTGCGTAGCTTCCTCGGCTGCTCCTCCTGTCACCAAACAACCCTCGA
GGCCTCTATCACCAATTACCACTCTTATGCATAGCTTATCGCAGGCAAGC
TCTTGCCTCACCGAGAAGAAGAACCGTTTGAAGGTCGTCAAGAAAAATCA
AAAGACTGCATTGAGCGATATTCGGAAGGAAACCGAGAAGAATAGATCCC
TCCTAGGGAATGACCGTGGCGATGAGCGGGCATTCCGAAGAATCCTGGCA
TTGAAGGAATCCATCAAGCGTGCTGATGAGGAGACCGAGAAAATGACAAA
GGAGATTGAAGGGCTGCAGAACCTTCCGGACAAGCTCAAGGCAGAGTGGA
AAGCCAAGAAAAGGGGTTGGCGTGAGGAGAGAGATAAACTTTTGTCCGCA
CAAAGTCAGGCTGGGGAGGTGAAAGAAGCGGCAGACCGCCAGACCTCAAC
AGTCGAGTCAGAAGCGGCGAGCCTGGTGCAAAAGAAGGAAAGGTTGACAG
TACGCCTTGGTAAACTCTGTGTCGATCTCGAGAAGCTCGAGAAGGAACAT
CAGCAGAATATTGAGACCCGCCGAAAGAGGGAAGCCGAGAGAGAGAATGT
TGAGAAGCATCGTCTCTCCCTCGAAAAGGAATTCTCCGATGCCATTCTCC
GTATGGAACAAAAGACGGTGGACTTTCGCATGTATTCTGCTGATAACTGG
GCAACCTTTTACGCTTACGAGTCCTCAATCCAATCCCAACCTCCTCTGTC
AACGCTTGATACTGGACTCCAGGGAACTAACAGCAACCGCAACTCTCTGC
ACATTTCCACCCCCCCCGGCCTTATGCTCCACCAAGGCTCTTATACCGCA
TCATCCTCGTCCCTACCGACTGGCACAGCCGGCCCCACCCGCGAGCGCTC
CTCGTCGGTATTTTCCAGTGAAAGTGTTGTGACAAACATGTCAGAGCTCG
AACGTTCAGAGGTGATCCGCTCCACCCACTTCCCCCGTGGAAACAGTCAC
GACCACATAACCCCGTTCTTCCCTGGGGCGGTGGGGGCGGGGTCCGCGCT
AGTA

Sequences in the Contig:

SY0AAA11YH01FM1 SY0AAA38YA06FM1 SY0AAA38YB01FM1
SY0AAA55YD22FM1 SY0AAA61YJ15FM1 SY0AAC21YD04FM1
SY0AAC24YG13FM1 SY0AAC28YB23FM1 SY0AAD3YN06FM1