Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3991
Length(NT) : 1005
Best Gene Model Blast : Link to GSTUMT00010318001 E-value : 1e-79
Numbers of ESTs : 3

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 450 E_value: 8e-43
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 409 E_value: 2e-38
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 281 E_value: 7e-26
PFAM Definition: No Hit Found
Swissprot: P16157|ANK1_HUMAN
Gene Ontology:
GO:0016323 = Cellular component: basolateral plasma membrane
GO:0005856 = Cellular component: cytoskeleton
GO:0008093 = Molecular function: cytoskeletal adaptor activity
GO:0019899 = Molecular function: enzyme binding
GO:0030507 = Molecular function: spectrin binding
GO:0005200 = Molecular function: structural constituent of cytoskeleton
GO:0007010 = Biological process: cytoskeleton organization and biogenesis
GO:0006887 = Biological process: exocytosis
GO:0045199 = Biological process: maintenance of epithelial cell polarity

Sequence:
>Contig3991
TTGGGGAAGGGGCATGATGGAGTAGTGAAGCTACTATTGGGACGTGGAGA
TGTCAACCCCAGTATGATAGACGATCGTGGCCAAACGCCGCTCTTGCAGG
CTGCTAGCAATGGGTGTGATGGGGTAGTACAGTTACTGTTGGGGCGGGGA
GACGTCAACCCCGATATGCCGAATAATAATGATGGCCGAACACCGCTCTC
GCGGGCTGCTGAGAATGGGCATGATGGAGTAGTAAAGCTACTGTTGGGAC
GGAAAGACGTCAGTCCCGACATGCCAGACGACGATGACCGAACGCCGCTC
TTGTGGGCTGCTGAGAATGGGCGCGATGGGGTAGTGAAGCTGCTATTAGG
CCGGGAAGATGTCAGCCCTGAAAGGCTAGACAATTCCGGGCGGACACCAC
TCCTGCTTGCTTCTTTGTGGGGGCATGAGGGAGTGGTGAAGCTGCTATTG
CAAAGGAAAGACACCAACCCCAACACCCCCAACAAAGCCGGTCGGACGCC
ACTCTTGTTTGCAGCCAGGTATGGACGCGAGGGAGTTGTGAAGCTACTAC
TGGAGCGAGAAGATGTTAACCCCAACGTACTGGACAAATACGGAAAAACG
CCACTCTGGTGGGCTTCTGAGAACCGGCATGAAGGCGTCTCGAAGCTACT
ACAAGCCCGTGAATCCACAAACCCCAGCATGGCTTAGGCCTAGCAAAACA
AAATGTTTTCCTATCATCCTCCGAAGCCGCCGTTTCCCGGTCCTCTAAAC
CGCTCTCATCTCCCTCCTAGAATGTACAGAAATCTCTCGGACATTATCAT
AGTCTTTTTTTTCCCCTCCTCTTTTCTCTCTCTCCGGATTCCTGATTCAA
TCCCCGTACTCTTCGATGTACGGGTGCCGATGTATTATCCCTGTAGTTAC
AATGTGAATTCTTAGTCTATGTTTTTGTTTTTATTCCACTTTGTGTGACG
ACATAGCGTTCAGGATTAGTCCATGTTTCCTGCTTGTAAATTACCACTTT
TATCC

Sequences in the Contig:

SY0AAC21YC13FM1 SY0AAC21YC13RM1 SY0AAD40YM12FM1