Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3990
Length(NT) : 221
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3990
TTGGAAATATGAAGACTTTTCTACCGCCCATACATTTTAATGGGTTGGAG
GACGTTTGAAGGGAACCCCTGATCCTAGCTGTCGGTCCTCCCAACCGTAT
ACTATGCCGGTGACGAGCTGAATGGGGGAAACGGTTCGGGTCTGAATCGG
TTCATGTTGGCGGGGAGAGCCATTCATCTGCGGTGCGCCTGATTCGAGGT
CGAGCTATCTTGGGGGGGGGG

Sequences in the Contig:

SY0AAC21YC11FM1 SY0AAC25YC07FM1 SY0AAC30YJ07FM1
SY0AAC38YF18FM1