Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig399
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00004012001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification, Transcription].
Kog Number: KOG0132 Score: 177 E_value: 4e-14
PFAM Definition: DUF1421, Protein of unknown function (DUF1421). This family represents a conserved region approximately 350 residues long within a number of plant proteins of unknown function..
Pfam Number: pfam07223 Score: 194 E_value: 5e-16

Sequence:
>Contig399
CTCCGACAATACTTCTCACCGGTCCCTGGGCGTTTCTGTTGGACATTAAC
CAAAGTCAAGGTGAGATTACTGTACGATATTTCGGCTCACATTCTGATCC
TTCCTTCATGAATGACTCTTTTTTTTTTTTCATTTTTCCATTCACTTGCG
CTAACAATCGCCCCACGAGCGGCTGAAGGCCCACACATATATTCCCGAAG
TCATCCCACTTTTCTCCTCCCCCGAACTATTTCCGCTCCGCGGTTGAAAC
CTTGAGCCGGAGCTTTCATCTATACCATGTCTTATCCACAGAATCAAAAC
CCCAACTATGGCGCTCCCGCCGGTGCCCCGCAGCAAAACTATTATGCCCC
CCCGGGACCCGGACAGCCATACCCGCCCAACCCACAAGGCTATCCAGCGC
CCGGAGTTCCCCCCTCTCCGTACGCTGGCCAACCGCCTTACCATCAGCCA
CAAGGCTATCCCCCACCAGGGCAGCCGCAGCAGTACTACCCGCATCCTCC
TCCCCCGCAGCAGGGCTACCCCCCGCATCCATCCTATAACCAACCACAAT
ACGCCCCACAAGGGCAATATCCTCCCCCAGGAGTCCATAACCCTCAGTAC
CCCCCCACGCCTCCGCAAATTACGTATCAACACCCTCCGC

Sequences in the Contig:

SY0AAA15YI08FM1 SY0AAA22YO12FM1 SY0AAA31YH10FM1
SY0AAA33YI19FM1 SY0AAA35YI10FM1 SY0AAA36YD15FM1
SY0AAB25YC09FM1 SY0AAB4YG05FM1