Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3989
Length(NT) : 710
Best Gene Model Blast : Link to GSTUMT00008251001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_03357
Accession: ref|XP_001558508.1| Score: 403 E_value: 1e-37
KEGG Definition: predicted esterase of the alpha-beta hydrolase superfamily
Accession: aor:AO090005001602 Score: 352 E_value: 5e-32
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2214 Score: 337 E_value: 1e-32
PFAM Definition: No Hit Found
Swissprot: O14115|PLPL_SCHPO
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0004806 = Molecular function: triacylglycerol lipase activity

Sequence:
>Contig3989
TTGGCCCATCCTACATCACCCTTCACCATCATCACCGCTGCGACAACCAA
GCTTGAAATATACTTATTTATACCAAGTCAGCATCATTTGTCTTAATGGG
AGAGTTTGCTCTCTCTGCACCTCCTTCCTATCCGAATGTATCAGCCGATA
GAAGCCATGTTTAACACTATGCCTTCCGGTATTGTTGTGCTCGTAGCATC
AATATGCAACGTATTTGTAGAGGTTTCAATGTTTTGGCAAAAGAAACTTT
GGGGATGGTATACACGCAAGAAGCCAAAAGAAGAGCTCCTAGAGAAGCTC
GCTGCAGCGAAATCTTATGAGGAATGGGAAGCGATTGCGGCTCAGCTAGA
CGAAGTGTTGGGGAATGATCTTTGGCGGCAAAATCCGACAAGCCAATATT
ATGACTATAAACTCATTCTCGATCGTCTTCAGAGTTTATCGGTAGCAAGG
AATGAAGGGAACACCTTACGGCTAGTTAACCTTCTACGTTCCGGTCTTCT
AAGAAACCTCGGAAATATATCCAACATAAATCTGTATAATCGCTCTTACG
CTGGAAGCAAGCGGCTTATCGAAGACTATATCTCAGAGGTTGGGATATGC
TTGGAGCATATTGCTTCGCTCCCGCCCCTAGCGTCCTTAACATCACAATC
AAAGCTTGACTTTCTTCATGATACTCGTCAATCATTTGGCCGTTCAACCC
TGGTTCTCCA

Sequences in the Contig:

SY0AAA6YO07FM1 SY0AAC21YB11FM1