Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3988
Length(NT) : 610
Best Gene Model Blast : Link to GSTUMT00009098001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1029 Score: 153 E_value: 3e-11
PFAM Definition: Caldesmon, Caldesmon..
Pfam Number: pfam02029 Score: 176 E_value: 6e-14

Sequence:
>Contig3988
TTGGGGTGAGGAGGGTCTACGAGGCGAAGCGCCAGGACGACCTCAACAGG
GCAAGAATTGAGAAGGAGTACCGGGAGAAGTTGGCAAGGGAGGCAGAAGA
GGCTGCTCGAAGAGCCGGGGAAATTGCTAGGCAGCAGGAGATGGAGAGGC
AAAGGCACGAACAGGAAAAGAGGGAGCAGGAACAGAGAGCAGCGGAGGCT
GCTAGGCTTCAGGCAGAGAGGGTGAGGGCCGAAGAGGAGAGGAAACGTCA
GGCGGATCTGGAGAAGGAAGAAGCTCTTAAGAGACAGAAGGATGCGGAGG
AAGCGAAGGTGAAGGCGGAGCGAGATTCTAAGGAACGAGCCGTCAGGGAA
GCTGCAGCCGCCCTACATGCTGCTTCCCGTTCTGGTCCGCGGGTCTACGG
TAGAAAATCTACGACTTACGAGAGAGTCGCAATGCAGAGAGTTATCGCGT
CTCTACATCAATTGCGTCATACCGTGCTCCAAGAGGAGGCGTTCTCCAAA
GAAAAGAAGTTGACTACTATCCGCCGCGGATTGCGTCCCAAGTTTGGTCA
GTTAAATGGTGAGAGAAATCAGACTATCGAAGTTCGTGACTTCCTTAAAA
ATACTTTTGT

Sequences in the Contig:

SY0AAC21YB01FM1 SY0AAC25YJ01FM1 SY0AAC26YJ01FM1