Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3987
Length(NT) : 472
Best Gene Model Blast : Link to GSTUMT00005677001 E-value : 1e-113
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein MGG_05427
Accession: ref|XP_360052.2| Score: 274 E_value: 4e-23
KEGG Definition: hypothetical protein; K10436 microtubule-associated protein, RP/EB family
Accession: mgr:MGG_05427 Score: 274 E_value: 2e-23
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Cytoskeleton].
Kog Number: KOG3000 Score: 167 E_value: 4e-13
PFAM Definition: EB1, EB1-like C-terminal motif. This motif is found at the C-terminus of proteins that are related to the EB1 protein. The EB1 proteins contain an N-terminal CH domain pfam00307. The human EB1 protein was originally discovered as a protein interacting with the C-terminus of the APC protein. This interaction is often disrupted in colon cancer, due to deletions affecting the APC C-terminus. Several EB1 orthologues are also included in this family. The interaction between EB1 and APC has been shown to have a potent synergistic effect on microtubule polymerisation. Neither of EB1 or APC alone has this effect. It is thought that EB1 targets APC to the + ends of microtubules, where APC promotes microtubule polymerisation. This process is regulated by APC phosphorylation by Cdc2, which disrupts APC-EB1 binding. Human EB1 protein can functionally substitute for the yeast EB1 homologue Mal3. In addition, Mal3 can substitute for human EB1 in promoting microtubule polymerisation with APC..
Pfam Number: pfam03271 Score: 163 E_value: 1e-12
Swissprot: Q10113|MAL3_SCHPO
Gene Ontology:
GO:0000235 = Cellular component: astral microtubule
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0005829 = Cellular component: cytosol
GO:0005828 = Cellular component: kinetochore microtubule
GO:0005634 = Cellular component: nucleus
GO:0051233 = Cellular component: spindle midzone
GO:0001671 = Molecular function: ATPase activator activity
GO:0051010 = Molecular function: microtubule plus-end binding
GO:0008608 = Biological process: attachment of spindle microtubules to kinetochore
GO:0000902 = Biological process: cell morphogenesis
GO:0046785 = Biological process: microtubule polymerization
GO:0007018 = Biological process: microtubule-based movement
GO:0008104 = Biological process: protein localization
GO:0007088 = Biological process: regulation of mitosis
GO:0051225 = Biological process: spindle assembly

Sequence:
>Contig3987
AAAGAACGAAATCACCTTAGTTCGAAGCGAATCTGTGAGAAAATACAATT
TTACTAATTGAAACCCCTGGGCGGCGAAAGTAAGAGTCAAGGAATAAAAT
AATCGGAGAAAGGAATCACTAGGAAAAGAAAAGAAAAAAAAAAATAAAAG
TAAGAATGTATCCGTTGAAAACGATGTTACTCCACGCAATGGTAAGCCTG
CCGTGGATCTTTTTTTATCCCCCCTCAGCCATCGCTTAAGCCCAAGCCCA
CATTGTAAACATCCCATCTAGAATGTCTCCAGGTCGTCGCCCTCCTCAGC
CGGTATTTCGAATCCATCCTCTGTGGAGTACAAGATCGCCTGGATATGCT
TGACCAGGCCGTCCTCATCCTCTTCAATCTTGGGATCCTGCTCGACAGCC
TGCTGAATTAACAATTCAATATCCCTCAACTTGCTAAAGTAGAAGTCCCT
CTCGCGCTCGAGCCCGGTAACA

Sequences in the Contig:

SY0AAC21YA08RM1 SY0AAC27YN09RM1 SY0AAC27YO07RM1