Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3986
Length(NT) : 721
Best Gene Model Blast : Link to GSTUMT00005677001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein SS1G_07164
Accession: ref|XP_001591718.1| Score: 597 E_value: 4e-60
KEGG Definition: hypothetical protein; K10436 microtubule-associated protein, RP/EB family
Accession: ani:AN2862.2 Score: 592 E_value: 8e-60
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning, Cytoskeleton].
Kog Number: KOG3000 Score: 466 E_value: 2e-47
PFAM Definition: CH, Calponin homology (CH) domain. The CH domain is found in both cytoskeletal proteins and signal transduction proteins. The CH domain is involved in actin binding in some members of the family. However in calponins there is evidence that the CH domain is not involved in its actin binding activity. Most proteins have two copies of the CH domain, however some proteins such as calponin have only a single copy..
Pfam Number: pfam00307 Score: 128 E_value: 2e-08
Swissprot: Q10113|MAL3_SCHPO
Gene Ontology:
GO:0000235 = Cellular component: astral microtubule
GO:0051285 = Cellular component: cell cortex of cell tip
GO:0005829 = Cellular component: cytosol
GO:0005828 = Cellular component: kinetochore microtubule
GO:0005634 = Cellular component: nucleus
GO:0051233 = Cellular component: spindle midzone
GO:0001671 = Molecular function: ATPase activator activity
GO:0051010 = Molecular function: microtubule plus-end binding
GO:0008608 = Biological process: attachment of spindle microtubules to kinetochore
GO:0000902 = Biological process: cell morphogenesis
GO:0046785 = Biological process: microtubule polymerization
GO:0007018 = Biological process: microtubule-based movement
GO:0008104 = Biological process: protein localization
GO:0007088 = Biological process: regulation of mitosis
GO:0051225 = Biological process: spindle assembly

Sequence:
>Contig3986
TTGGCTTCGCAACACAACCATTGCCTTCTCCCGAACATTTTTCTGCGCTC
GCTCTCGCTTCCTCACAGGACCATCGTTAAGAAAAATAATTCTTCCTCAA
TCTTCCCAACGAACACCTATACCTTACCTTTCCTCACTTCTTGACTTTTT
TCTATACAACATGGGCGAATCAAGGCAAGAACTTCTCAACTGGTTAAACG
GCCTCCTGCAGCTTAACATTACACGTATAGAGCAATGTGGAACCGGTGCC
GCGCTATGCCAGGTTTTTGACTCTATTTTTGGCGATGTTCCCATGCAGAA
AGTCAAGTTCAACGTCAATACCGAATACGCCTATCTTCAGAACTTTAAAA
TTCTTACCTCCGTCTTTTCTTCAAAAGGAATTGATAGACCTATTCCCGTC
GAGCGTCTAGTCAAATGCAAGTTCCAGGACAATCTTGAGTTTCTGCAATG
GACGAAGAAGTATTGGGATCAGTACTATCCTGGCGGCGATTACGATGCGC
TCTCCCGCAGAAAAGGTGCGGGCTCGGTCGGCGGCAATCATCCTCCCGCC
GCCCGCGCCAATACCTCTTCTGCCGCAGCGAAACGTGGAACTACCCCGAC
GGTTGGCGGTGCCCGAACCAGAACTCCCCTCGGTGGTGCTAGCACTGCCG
CGCTCCAGCAGGAAAATAGCATGTTGAAGGAGAATGTTACCGGGCTCGAG
CGCGAGAGGGACTTCTACTTT

Sequences in the Contig:

SY0AAA2YI09FM1 SY0AAB12YN23FM1 SY0AAB30YE15FM1
SY0AAC21YA08FM1 SY0AAC27YN09FM1 SY0AAC27YO07FM1
SY0AAD49YJ04FM1