Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3985
Length(NT) : 863
Best Gene Model Blast : Link to GSTUMT00011330001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_02334
Accession: ref|XP_001559170.1| Score: 702 E_value: 4e-72
KEGG Definition: hypothetical protein
Accession: ncr:NCU07011.1 Score: 655 E_value: 5e-67
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1539 Score: 697 E_value: 4e-74
PFAM Definition: Utp21, Utp21 specific WD40 associated putative domain. Utp21 is a subunit of U3 snoRNP, which is essential for synthesis of 18S rRNA..
Pfam Number: pfam04192 Score: 348 E_value: 1e-33
Swissprot: O14053|YC47_SCHPO
Gene Ontology:
GO:0000935 = Cellular component: barrier septum
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0005819 = Cellular component: spindle

Sequence:
>Contig3985
TTGGTGGATATTGAAACCCGCAAGACTGTACGAGAGCTTCGGGGCGCGCA
AGGAAGGATAAATGACTTTTGTTTTTCGAACGACGGGAGATGGATCATAG
GCGCTTCGACGGATAGCATTGTCAGAATTTGGGATTTACCAACTGGGCAT
TTGATTGATGGTATTAGGACTAAGAGTATTGTTACTGCTATGGCGTTTTC
TGGAACTGGTGAATTCCTGGCGACGGCTCATGTTGATAGTGTTGGGATAA
ACCTATGGACAAATAGAACTTTGTTCAAACACGTTCCGACTAGACATCTT
GATGAAAAGGACATAGTAGACATGACTGCTCCGTTAGCCTCTGGAGAAGG
GGGTGTCGGTGTCATCGAAGCTGCACTTAGCCCCCAGGACGATGGAGAGG
ATGGCAGCACCCGCACATACACCACATTAGACCAACTGAGCAGCAACATG
TTGACAATGTCACTCGTCCCAAGGACAAGATGGCAGACTTTACTTAACCT
TGACGTTATCAAGCAACGAAACAGACCGAAGGAACCTCCCAAAGCTCCTG
AGAGAGCCCCTTTCTTTCTCCCCCCACTCGGCGCAAAATCTGATTCATTC
GCACCAGCTGCCGGGAAGATGATCAGTGGCACCAACAGTGCCCAACTAAC
CGACTCTCAAACCCTTGAAGCCGAGAGATCCCGCGTCCTCCGCATGAGCC
GGGATAGCGGTGAATCTACCTTCACCAAACTCCTTCGCGAAGCTGCAGAC
CGCAATAACGGAGACTACACCGTCTTCCTCGACCATCTGAAAACGCTCTC
ACCCTCGACAGCAGATCTAGAAATCAGGAGTTTGCAAGTAAACGAGCTGG
CACAGTTCGTGCA

Sequences in the Contig:

SY0AAB14YN15FM1 SY0AAC21YA05FM1 SY0AAC28YB18FM1
SY0AAD40YI13FM1