Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3984
Length(NT) : 295
Best Gene Model Blast : Link to GSTUMT00000459001 E-value : 1e-42
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_03762
Accession: ref|XP_001794310.1| Score: 128 E_value: 4e-06
KEGG Definition: proteasome component Pre4, putative [EC:3.4.25.1]; K02736 20S proteasome subunit beta 7
Accession: afm:AFUA_6G06450 Score: 123 E_value: 6e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3984
CAAAAAAGTATTTGATTCTAGTCATAAGTGTTCGCAAAAATAAAGCATTC
ACCATTTGTCCATTCTGTGTGTCCCACATGTTCACTGGAAACGCCCCCCA
AGCTCTATCCATACACCTAGACAACTTGTGTTCCATAGCCTCTAATACCC
TCGGCAAACTTCCAGCTCTGGTTCTGAAGTTCAATATCCTTCTCCCATTC
GATATTGACCTTCGCTTCACACTCTGCAGCACCCTCCACATCCTTTCCGG
TGATTATAGCCAAGGAATACTTGCTCAAGCTTCGAGCATCACGGT

Sequences in the Contig:

SY0AAC20YJ13FM1 SY0AAC20YP13RM1