Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3982
Length(NT) : 1424
Best Gene Model Blast : Link to GSTUMT00011059001 E-value : 0.0
Numbers of ESTs : 31

Blast Results:

Nr Definition: geranylgeranyl pyrophosphate synthetase
Accession: ref|XP_960695.2| Score: 1049 E_value: 1e-112
KEGG Definition: GERANYLGERANYL PYROPHOSPHATE SYNTHETASE (GGPP SYNTHETASE) (GGPPSASE) (GERANYLGERANYL DIPHOSPHATE SYNTHASE) [INCLUDES: DIMETHYLALLYLTRANSFERASE ; GERANYLTRANSTRANSFERASE ; FARNESYLTRANSTRANSFERASE ]
Accession: ncr:NCU01427.1 Score: 1049 E_value: 1e-112
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG0777 Score: 992 E_value: 1e-108
PFAM Definition: polyprenyl_synt, Polyprenyl synthetase..
Pfam Number: pfam00348 Score: 518 E_value: 4e-53
Swissprot: P24322|GGPPS_NEUCR
Gene Ontology:
GO:0005625 = Cellular component: soluble fraction
GO:0004311 = Molecular function: farnesyltranstransferase activity
GO:0006720 = Biological process: isoprenoid metabolic process

Sequence:
>Contig3982
TTGGCCACCACCAGCCGGCATCGTCACTCGCCCACATTAAAACCTCTTAA
ACCACGGGTCGATTCGGACGCTCCAGTTCAGAATGGAACACCCCAGACTC
GGAGCGCTGATGTTTTGGTAGCCGCTGGATTTCAACGTCAATGGTCCGAG
GAGAAAGAAAATATATTACTTGGGCCTTACAACTATCTTGTCTCCCATCC
AGGAAAAGATATCCGCCAGCAATCCATAACGGCCTTCAACAGCTGGCTGC
AGGTTCCTGAAGTCTCTCTTCAGATAATTACCAAAGTCGTAGCTATGCTA
CATAATGCCTCACTTTTGGTCGACGATGTTGAAGACCGTTCTAATTTGCG
ACGAGGTTTCCCTGTAGCGCACAGTATATTTGGGGTAGCACAAACCATAA
ACTCCGCGAACTATGTGTACTTCCAGGCCTTACAGGAACTTTTGAAACTC
AACAATCCATTAGTGCTCAGGATTTACACAGAGGAACTACTGAATCTTCA
TCGGGGCCAGGGGATGGACCTCTTCTGGAGAGATACATTGACAACACCGA
CCGAGGATGACTATCTGGAGATGGTTAGCAATAAAACTGGTGGGTTATTC
CGTCTGGCTGTGAAGCTCATGCAAGCCGAGAGCGCCTCGGACAAAGATTA
TGTTCCCTTGGTCAATATTATTGGTCTGCTTTTCCAAATCCTCGATGATT
ACTTAAATCTCCAATCAAATCAGTACACCAAGAATAAGGGATTCTGTGAG
GATCTTACCGAGGGAAAATTTTCATTCCCTATAATCCACGCCATCCGCAG
TGATCCATCCAACCGTCAACTGTTAAATATTTTGGGGCAGCGAACTACAG
ATGAGGATGTCAAAATGTACGCCGTTGCCTACATGAAAGACCAAACAGGC
ACCTTTGACTACACGAGGAAAGTTATCCACGATTTACACAAGAAGGCATT
GGAGGCGGTTGAGGAACATGGTGGAAACCCGTTACTGGTCGCGATATTGA
TGAAATTGGTGGCTAGATAAGGGAACTGCTTCCTCCCTAAGGGGGGAGGG
TTATTTCTGGAGTGATTTTTTTTCCCTTTTTTTCCTTTTTTTCCTTTTCT
TTTTTTTTCTCTTATTTATATCGATGGGTGTAGGTCTTTCACCCCACCCG
ATGTTATATCAGGTTTATTTTTTCTTTGGGGTTTAGGTCTTTTCTTGGGC
ATCGGGAAGGCTAGTTTGGGTTTGTTACGAATGTCATTGTTTCAAGGGCA
GCATTTCTTTCTCTTGCATTGGGGTTCTTGACATTTGCAAAAGCTTATGT
ATTTAGCTCTGGGATCGTGTTGTGTCATTGCTTTTTTACGTGGGCTAGTT
TTAATGTAGCTCCCATCGTGCACCCGCTCATGAGTAGAGACCATAGACAA
TCTAAAGCTACATATCATATTCAG

Sequences in the Contig:

SY0AAA26YK02RM1 SY0AAA28YK11FM1 SY0AAA40YC01FM1
SY0AAB20YD14FM1 SY0AAC18YB17FM1 SY0AAC18YM23FM1
SY0AAC20YO24FM1 SY0AAC20YO24RM1 SY0AAC26YC03RM1
SY0AAC27YG05RM1 SY0AAC28YE10FM1 SY0AAC28YE10RM1
SY0AAC29YF16FM1 SY0AAC2YO15FM1 SY0AAC48YB14FM1
SY0AAC57YD04FM1 SY0AAC58YK17FM1 SY0AAC61YH18FM1
SY0AAD12YL14FM1 SY0AAD14YL19FM1 SY0AAD14YP22FM1
SY0AAD15YK12FM1 SY0AAD26YA18FM1 SY0AAD26YG20FM1
SY0AAD2YE01FM1 SY0AAD39YK17FM1 SY0AAD44YN13FM1
SY0AAD5YJ16FM1 SY0AAD61YA21FM1 SY0AAD61YJ10FM1
SY0AAD62YL06FM1