Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3981
Length(NT) : 2791
Best Gene Model Blast : Link to GSTUMT00000850001 E-value : 0.0
Numbers of ESTs : 22

Blast Results:

Nr Definition: mRNA export factor mex67
Accession: ref|XP_001265156.1| Score: 838 E_value: 3e-87
KEGG Definition: hypothetical protein
Accession: ani:AN2737.2 Score: 796 E_value: 1e-82
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3763 Score: 548 E_value: 3e-56
PFAM Definition: TAP_C, TAP C-terminal domain. The vertebrate Tap protein is a member of the NXF family of shuttling transport receptors for nuclear export of mRNA. Tap has a modular structure, and its most C-terminal domain is important for binding to FG repeat-containing nuclear pore proteins (FG-nucleoporins) and is sufficient to mediate nuclear shuttling. The structure of the C-terminal domain is composed of four helices. The structure is related to the UBA domain..
Pfam Number: pfam03943 Score: 116 E_value: 3e-06
Swissprot: Q9Y8G3|MEX67_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005730 = Cellular component: nucleolus
GO:0005819 = Cellular component: spindle
GO:0046982 = Molecular function: protein heterodimerization activity
GO:0006406 = Biological process: mRNA export from nucleus

Sequence:
>Contig3981
TTGGCTGCCCAAACACTCTTCTCGAAGGTCTTCAAAAAAAGGAAAATATC
CCCCAACATACCAAAATACCAAAAACCAGCCCTCTCTGCTCTGCTCACCC
CCATCACTATTTATCTCCCATCAAGAGTCGTTTTCACTTCGAGCACCGAC
CAACGCGTTTAGGGATCGAAATTGTCAACTCTACAAGTCATCCCATATCC
GCTCCTCTCGGGTCTTCCCGTTATAGGCGGTATACGGATACCAGAAACCC
CCCCCCAAAAAAAAAAAAAACACTCCTAAACAAACACTCCTAAATAAACC
TTTTTCTCCTTCCCTCCCAACTTGTGTGCCACGGCCGTCGTTTAAACGAA
GGTCCGTACTCACTAAACATCCACAAAAAAACAAAAAACAAAAAACCCTC
AAAGAACTGCAAACATTCAGATAGCAATGAATTCTACTGCTCTTCGCCCC
CAGGGGTCTCATGGCGGCATCACCAAACGCGCTGGTGGTCGTACTCGAAT
TGACAGAGACGGAGATCTTGATATGGATGGTCCTTCTGGAGGACGCGGTG
GCCGTGGCCGAGGAAATAGAAACAGGGGCGGTCGTGGTGGTGGGGCCGGT
GCTGTTTCTAGAGGAGGGCGATCGGGCGCTGGTTCTATTATCCCCGCTGG
TCCTGCTGCCAGTCGTATGGATCTGAATCAGAACAGGAATAGGGGGATCC
CAGCGAGAGGTCCTCGGAATGGAATAGTATCCGTTTCTGAAACACTAGTT
GAGGTTAGAATCACAGGGTGGAAGGATAGCAAGGGTTCTGCGGAGGAGGC
AATCGCTTTCCTGGAGAGGAAGAGTCGAGTGAAGCTTCGAAAGACCTTAA
AACAAGGAGACACCATCATCGCCCAGGTCCCATTCCCAAAGATTCACTCG
ATTCTAGAATGGAATGACGCCCAATTTGCATCTTCCAAGCTAAGGCTAGC
CGCACCCAGTCTCGGCAGACTCGACGTTACAGAGAGGAGTGAGGCGGTTA
TCTCACGAGCCAATCCAGCGAATAAGGATACCGTGGACACGATCCTAGCC
CTTGAGGGCGTTCTTGCGAATCGGTATAATCCCGAGAGCAAATTCCTAGA
TCTATCACGGCTCGGTGAGGATGCACTCCTGAAGGCAAACGGCTTCTTCC
AACTCAGCAGCACAACCAGCAAGATGTTCCCAGCGCTCATGCAAGTAGCT
GAAAAGAAGTTCACGACGGCGCAGCAAAAACGTGACACGGTCCACAGCGT
ATCGCTAGCATACAATAACCTAAAGGACGTCCGCACCGTCACGAGCCTGA
GCGTAACGTTTCCGGACTTGAAGAACTTGAGCCTGGAAGGAAATTCCATC
CAGGACTGGAACACACTGGACAGTTGGCGCCACAGGTTCAAGAACTTGGA
ACAGTTGGTCCTCAGCGGAAACCCGATCACATCACAACAGGGCTACGTAG
AGGAGGCCTACCGGCGATATCAGAAGCTTTTAATGCTGGACAATATCCCT
GTGGACCCCGCGATCAGACAAAAAATCACGGCGGAGGGCGCAGCACCCGT
CCTCCCGCACAAAGTCCAGTCAAGATTCATCCAGGACGACTACGGCGTCG
GCATGAAGTTCCTCTCCCGCTTCTTCGAAGCCTACGACGCGGACCGGGTC
TCCCTGCTCCGCGAGTTCTACGACGGTGAATCTCTCTTCTCCCTCTCGGT
CAACACGTCCGCGCCGCGCACCAAGGAGCAGCAAAACACCCGCCAGTTCT
GGGACGAGTACATCCCCAGGTCACGCAACCTGAAGCGCGTCTCGCACTTG
AAGGGCCGCACCGATAGACTCGCCATGGGGCCCGACGAGATCGCCAAGTT
GTGGGGCGAGCTGCCTGCCACCAAGCACGACCTTGCCAACGGTGATGCTT
GGAGCTTCGACATCTGGCCTGTCGAGGTCACGTCCGGCGTCATGGGCGTG
CTATGCACCGTACATGCCGAGTTCCAGGAACTCAATAAGGTGGACGGCCC
GCAGAAGGTTGTCCGCCGGAGCTTCGACCGCTCCTTCATGCTGCGGCCGG
ACGTTCTCGGTAAGGTTAAGGTGGCCAATGACATGTTGGTGGTCAGGGCC
TATGGTGGCTTCGATAGCTGGAAGCCGGAGGATGGGAGTGGGAGCGCTGG
AGGTGGAGGGGAGCAGGAAAAAGGAGAAGCAGCGAAGAAGTCCATGTGTG
AGCAATTGATGGCGCAGACCAGGTTGAGGTCGGACTGGGCTACCATGTGT
CTTTCGGAGACAGGGTGGAATATTGAAAGTGCCTGGAAGGCGTTTTTGGA
GGCTAAGGCCAACGGCGCAATCCCTCCGGATGCATATTTGCCCGATTCTA
CCACCGCTCCTGCCACTGCCATTGGCGCGAATACTGCGGGTGGCCGAGAT
GGGATCTTATAGGGTGGATCCATCAAACCCCTTTCCTGTCTTCATGTATC
AGAATCATTGTACAGAAGTCACGGGCGACTACAGCTTTTGTTTCTCTCTT
TTTTGCGCATTTTCATATGTTGGGTTGGCTGGCTAGGGATGGGCTCCCTT
TCGTTCATTCGCACATTGATACTCAAGTACAGTACCATATGTCTTTGTCT
CTCTCCTTTTTTTTTTGCTTCTTATTATATGTTTGTTGGCTGGTCTGCCT
GTCTTAGTTAATGTATCTTGCCCGATCGCAATTGATGGATGGGGGGTAGG
GGTATCATCTTCGTCGCCGTTATTATTATCACTCCGATGTTATCAAAGTT
CGTTAGACCGGCTGAAGTTTTTTATTTTATTTTCTTGATTA

Sequences in the Contig:

SY0AAA33YP21FM1 SY0AAB14YH05FM1 SY0AAB16YC21FM1
SY0AAB1YM20FM1 SY0AAB36YD07FM1 SY0AAC20YO13FM1
SY0AAC20YO13RM1 SY0AAC26YJ24RM1 SY0AAC29YF02FM1
SY0AAC31YB23FM1 SY0AAC31YB23RM1 SY0AAC36YI02FM1
SY0AAC37YF13FM1 SY0AAC4YE11FM1 SY0AAC51YA04FM1
SY0AAC51YE19FM1 SY0AAC62YC19FM1 SY0AAD35YD19FM1
SY0AAD36YI21FM1 SY0AAD44YN02FM1 SY0AAD47YM13FM1
SY0AAD6YN17FM1