Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig398
Length(NT) : 915
Best Gene Model Blast : Link to GSTUMT00003332001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: hypothetical protein FG09840.1
Accession: ref|XP_390016.1| Score: 637 E_value: 1e-64
KEGG Definition: hypothetical protein
Accession: fgr:FG09840.1 Score: 637 E_value: 7e-65
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4212 Score: 240 E_value: 4e-21
PFAM Definition: RRM_1, RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain). The RRM motif is probably diagnostic of an RNA binding protein. RRMs are found in a variety of RNA binding proteins, including various hnRNP proteins, proteins implicated in regulation of alternative splicing, and protein components of snRNPs. The motif also appears in a few single stranded DNA binding proteins. The RRM structure consists of four strands and two helices arranged in an alpha/beta sandwich, with a third helix present during RNA binding in some cases The C-terminal beta strand (4th strand) and final helix are hard to align and have been omitted in the SEED alignment The LA proteins have a N terminus rrm which is included in the seed. There is a second region towards the C terminus that has some features of a rrm but does not appear to have the important structural core of a rrm. The LA proteins are one of the main autoantigens in Systemic lupus erythematosus (SLE), an autoimmune disease..
Pfam Number: pfam00076 Score: 166 E_value: 1e-12
Swissprot: Q9P3U1|YKX5_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig398
CAAGCTCTTTTACGCTTCTTGTTTTCCTCTAAAGCTAACTCGACACATTT
CTCGCGAGCAGAGAGTGATTCCTACCGCCCAGCAGCCTTAGAAGGAGGCC
GATCTATTGAACGCGAATACAGGCACCGTGATAGATCTCGTTCACCACGT
CGTCGTTCTCCAGACCATCGTGATCGCGCAAGGTCACCACGCAGTCCTCG
CCATCGTCGTAGATCATACTCACCTCGAAGCAGATCTCGAAGCCGGGACG
ATTACAGAAGGCGGTCCTCTCGCTCGCCTATGAGTGGAAGTGGCGGTCAC
CAAGGGGGATATTCAGGATCTGGATACCAAGGCAGTAGTGGAGGGGCTGG
TGGACCTCGTCGAAGTTACGAAGAACGTGCAGCCGCAAAGGACGCTATGA
TGCAGAGCCTTCGTGATAGTTCTCAGCAGGACCGCCGAGTTTACGTCGGA
AACCTTTCCTACGATGTCAAATGGCATCACCTTAAAGATTTTATGCGACA
AGCCGGAGAGGTCCTCTTCGCCGATGTCTTGTTGCTTCCGAATGGAATGT
CGAAGGGATGCGGGATTGTGGAATATGCCACTAGGGATCAAGCTCAGACT
GCTGTTAACACCCTCAGCAATCAAAATTTAATGGGCAGACTCGTCTATGT
CCGAGAGGATCGTGAGGCAGAACCTCGCTTTACTGGCCAGCAAGGCACTC
GTCCTCCCTACCCTGGCGGTCCGCCGGGTAGCAGTTATCCTGGTAGTGGA
TACTCTGGCGGTGGCGGTGGGGGTGGTGGTGTTCCTGGGGCCGGGGGGCG
TCAGATATACGTGTCTAATCTCCCTTACACTGCTGGTTGGCAAGACTTGA
AGGACTTGTTCCGTCAAGCTGGAGCCGTTGTGCGTGCCGATGTTCACATT
GGCCCTGACGGGCGC

Sequences in the Contig:

SY0AAA15YL19FM1 SY0AAA21YA17FM1 SY0AAA22YO10FM1
SY0AAA26YK15FM1 SY0AAA27YD22FM1 SY0AAA34YC15FM1
SY0AAA34YD20FM1 SY0AAA38YP23FM1 SY0AAA42YJ11FM1
SY0AAA9YO10FM1 SY0AAA9YO15FM1 SY0AAB22YM04FM1
SY0AAB49YF16FM1 SY0AAB55YI14FM1 SY0AAC24YF16FM1
SY0AAD11YK02FM1 SY0AAD32YA23FM1