Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3979
Length(NT) : 769
Best Gene Model Blast : Link to GSTUMT00008306001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE60968.1| Score: 329 E_value: 5e-29
KEGG Definition: 3-phosphoinositide-dependent protein kinase (PDK1) [EC:2.7.11.1]; K06276 3-phosphoinositide dependent protein kinase-1
Accession: aor:AO090012000858 Score: 329 E_value: 3e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3979
TTGGGAATGGGCATACGGAAACACCCAAGAAATTCGCTAGGTTCTTTGGT
AATGGTGGCAAAAAGCGGCAGAGATTGGTTATGATAACCACGTGTGCTCG
CGTAATTGTGGCTGCCGCTGGAGATGACAAGCGTATGAAATTAGAAATTA
ATTTACAGGGGCTTGGCGTTGTGGCTAGAAGTATAGGGGGTAGTGGTAGC
ACATCTTGGGCCATTGATACCCGCGATAAAACTTACACCTTCGAAGACCC
TAAAACCCTAGCCAGCGAATGGCTAGAAACCGTCGACAGGGCTCGAGAAA
TAGCGGCAGTTAATTACCCACCTGACGACGGTTTCATGTCCAGCAACCTA
TCTAGTCCGGCCTCGACAATCACCCTGGAGGCCGGAAACGGACCGTTTCA
CCACGACAAGTCTGGGCGAGAAGGAGATGGGCACGGCAGTAGGGAAAAGT
CGAATAAACGGTTCTCCAAGCGGAACTCTCGGCACGGACTGGCAGCGGTG
TTTTGACAACGAACTAAGCTCTGAATCCCGAGCTTTCTACTACTTTTTTC
TTCATTTTTTCTCTTCCGTTCTATGATGCTTAAATTCCATTATACTTTAT
TGTAAACTCGGCTGGATGGAAGTGTGCTGTGTGACGCGAAGCTTGGGGAA
CCAACGGGTACCGCACCGGTAGCCTACTTACTATAGGGAGAAAGTCCGGT
GGGGGCGGATGGGAATCATAATGTTGATATGTAACTTTGAAGCCTTTTTT
TCTTTCTCGTTGCTTTCTC

Sequences in the Contig:

SY0AAA42YO17FM1 SY0AAA9YB18FM1 SY0AAC20YO10FM1