Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3978
Length(NT) : 379
Best Gene Model Blast : Link to GSTUMT00003912001 E-value : 8e-91
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein
Accession: ref|XP_500036.1| Score: 193 E_value: 1e-13
KEGG Definition: hypothetical protein
Accession: yli:YALI0A13321g Score: 193 E_value: 5e-14
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q08977|YP260_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig3978
ACCCATACAGCATGAAGTTGGCTTCAATCGAGAACATGAGGGCAGATGGC
AGGTTCATGGTCGGGAACGATATCCCAGAAGGTCAAGGAAGGGTCAATTC
GTTGTTGGCCGAATGCTTCGAAATCTGCCATGATCTTAGAACGAGCTGTC
AAAATGCAGGAGACTAGGATGATATTAACGCCTACTCTATATGCACTCCA
GAGGATTGAAGTTCACTTCTGGCTCACTGCCTTTTGTTTTATCCGGGTTC
GAGTCTGGATCATCAAGATGATAACGTTTGTATGGATATCAGGCGCAATA
ATTTAAGGGCATGGTTATTAATTGAGCTTTGGTATATACAATATTGATTG
GCAAAGCTCGGCTTTGTTTTTTCTTTGGG

Sequences in the Contig:

SY0AAB3YH11FM1 SY0AAC20YN24RM1