Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3977
Length(NT) : 3270
Best Gene Model Blast : Link to GSTUMT00004040001 E-value : 0.0
Numbers of ESTs : 106

Blast Results:

Nr Definition: hypothetical protein BC1G_04470
Accession: ref|XP_001557220.1| Score: 540 E_value: 1e-52
KEGG Definition: predicted protein
Accession: aor:AO090003000066 Score: 443 E_value: 1e-41
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG3589 Score: 116 E_value: 4e-06
PFAM Definition: RGS, Regulator of G protein signaling domain. RGS family members are GTPase-activating proteins for heterotrimeric G-protein alpha-subunits..
Pfam Number: pfam00615 Score: 158 E_value: 5e-11

Sequence:
>Contig3977
TTGGCAGACCCTCCAACACCACCAATGTCTTCTAACGTTCCTATTTAGCA
CTCCGCCCGCGCTTTCAATCTCGTCTTCCACATACACACTCGACTCGATT
ATTGCCATTCGGGACTACACTTCTTCAACTTACTATCCGGTCTCAGCAAA
GTGTTCTCTCTCTTTCTGATCAGACCATCACCTTCCTTCATAAATATTCT
CTCTTTGTCTGTCTTTACGTCCTTTACAAAGTGGATTATTTGAGCAGCAA
ACAGTCGGTTTCGTAGGGATCGAGGACCGATCTTGTACCTCTTACACTCA
CTCACCTATATCCCTCCAACACAACTCACATTCACAGTATGGGTAGTCGG
AGATCAAGACGTCCTCCTTCATTGAACCTTTCCCTATCGTCTCGCGAAAC
ATCTCCCACAAACAGAACTACACCTTCCCCCGATCCGGATACGGACGACG
AACGCATGTCAAACGGGTATAATAACAACCGGCCGCTGAGTGTAGCGTAC
CCTACGGGCCCGTACTGTGTAAAACGACCGTCATTGTCGGAAGTATTATC
AAACACCGCAGGAGCACCGTTCACCCTTACCGCTTTTATGGCCTTTCTCT
CTCAGAACCATTGCCTTGAGACCTTGGAGTTTACAATGGATGCCACTCGA
TACCGAAAGTACTTCAATGCTTGTGTTGCAAGCGAGGACAACAAGTCTGC
TGCTGCTGCGGAGAAGGGACGTGAATATGTACGGATGTTGTGGCGGAAGA
TACTGGATGCCTACATTGTGCCCAATGGTCCTCGCGAGGTTAACTTGCCT
TGCACCGTACGGAACCACATTCTTAACCTGCCATCTTCTCGGACACCGCC
ACCACCGGAATCGCTTGATTCAGCTGTAAATATCGTCTATGAGCTGATGC
AGGAAAGCGTCCTAATGCCCTTCATTAGCGACTGCCAGCAACAGGCCGCG
TGTGCGGGACATTACCCATGGGGAGAGGCCGCACAGTCAGATGAGAATTT
GTGCATGCGTGGGAGTCTTGATGAGCGGTTTTTGAGGAGGAGGAATAAGA
GGGATTCTTCGCCTCCACCACTATTGGATTTTGTGTCGAATTCCTACTCG
AGCGGGTCCACTCGCCAACAAAGAGTGGCTTCTCCTTTCAGTGCGAGTTT
GGGATGGCACAGGAATTCAGCTGGGATGGGTCCTGGTTCTTGGGGTTCGG
GTAGTGGTGATAGTTTAATGATGATGGTGGAGGATTCTGGCACCTCATCA
CCGGGGTCATTTGCAAATCCTATGACGCCGCCTACCACTCCACCGACCTG
TGAATCCATGCTCTCCACCTCGACCACCAGCTCTCCAAAGCACAAGGCAA
CTGTAGACAAGGCAGCCAAGGGTTGGAAGAATATGACAGACCTTAGGAAT
TTGGGAAAGCAGCTTGGCTGGAGCAAGAAGAAGGGCCCTCAAATCTGGAG
CGAGAACGGCAGTTTCTAATTATTTTTCTTCGACCTACGGATTCCTCTAC
CAGTTCATTTTATTAATCCGATATTTTTATGCTGCCACGAAGTCGACGAA
TCTTATACTTGTTATATCTTCCAATCATTGGGTTGATATGCGGTTTTTTA
TCTACGACACACCATTTAGACACGAATCACGTCCTTACATAACCCTCTAT
GATACGCTAATTCGCATCGTTATCCTCTACCACTACTAACTTAGTCGGGG
ATAAACGGGCATCATCATCATCATCGACCCTCTTCACCTGTACTTTTACA
AAAAAGCGGACGGTTTCATTCTTCAAAAACCTTGCATTATCTATTACGGG
GATTTTTCTTTTCTTTTTTTACATTGTGTTTTTTCTGTTTTTGCATTGTA
CCTACGGCGCATTTGGGCGTACTTTTTTTTTGGAGCAATGGTGGACGAAA
GGGATAAAAAGAGTCTGGGAGTTTCATATTTCAACATTTTCCTTACGGTT
GAAGGGTTCATCAAATGAGGGGAGGAATGAGGAGCATATTGCTGCTCTTG
TTGAGTATCGCAATTATTATTTTTTGCCTCCTTGGGACGAAAAAAAAAAG
AGTAAAGGATGGATCATATTTTTTTGGGGTTTTTCTTTTCTTTACAAATC
TCCCAGACTTTTTTTTATTTCCTTTCTCTTGGGAAATGGGTCTTATTTGT
AACAGAACCCTTATTTTCCATCTGTATTATGGATTTTTTCTTCTTCCCCT
TCTTGTCATTATTATTACCCCTCATATCGTAGGGCGGCTACCTTTTTTTC
TCTGGTTGTCTTATTTCTTTCATCGAAACTTTATCGCATTGGTGCGGGAT
AGGATAGGACAGGATAGGGTGAAGGGGGGTGGGGAGTCCAGCGATGTGGT
TTTGGGTAGGAATGAAGAAAGAAGTCTTGCCAAAATATTCACACAATTTG
GTAGCAACCAGTTTGGTGGTTCCAAGATGAATAGGTTTACTCGAAATCCG
CACTGCATTTTTTTATGGGGAGTAAAATTGCTCAGGTAATATGTGATAGA
ATCATCGTGAACTTTTGGAAGATGCACTTTTTCTTCTTTCGTCCCCCTCC
AACAATTTTTCTGGGGGATCGAAGGATGAATGAATAATCTGAAAAGAAGA
AAAGAAAAGAGGGAAGCCCCATTGCGCATACCGAACTGTGCACTTGGCGA
TGCCGTGCTACAAGCACTGGTTGATAAGCTGATGCCTATGATACACCACA
GCACTTTTCCTCTCCTTCCACTCTATCGTTTTTAACCAGAAGCTGGATGT
GATGTGCACCACCACAAAGTAAGTACCTTACCGCAACTCACTCACTCGTT
TTAGCAGACACCACAGCGATAAAAAACCAGGAGCTATTTGCGGGACCTTC
CCACCACCACCACCACCACCACTGCCCTAGGCAGGAATGTGGGACTTTTC
TCTCTCTTTCTCTTTTTTTTTTTTTTTGCAAAAACCAAAAGTGAAGGAAT
AGTTGAATTGATTCGGATAAGGTACTATAGTGCTTGTACGAGTAGATAGT
CTAGCTGCCTGTGCTTGCGGGGAAGGAAGAAGGAAGTTTGCGAGGAAAAA
AAGAAAGTATCCTTAACTGATCTCAGTCAACTAACGGGATATTAGACATC
ATCGTCGTCATTATCTACGTATTTTGGAGGGATGGGTGGGGGGATCTACA
GTACGTACTTTTTAGTTACGGGGAAGGGTTGGGAAAGTGGGTCTGGTTAA
GGGTTTGGGTTGGATATGTGTGTGTGTGTTTGGGGCTTCGATATGATGAA
AGGATGAAAGGATGGATGGA

Sequences in the Contig:

SY0AAA14YK23FM1 SY0AAA15YI15FM1 SY0AAA16YH03FM1
SY0AAA16YK06FM1 SY0AAA1YM19FM1 SY0AAA20YL24FM1
SY0AAA21YP14RM1 SY0AAA24YD10FM1 SY0AAA24YD10FM2
SY0AAA26YC07FM1 SY0AAA40YO22FM1 SY0AAA57YA04FM1
SY0AAA58YJ14FM1 SY0AAA60YH07FM1 SY0AAB20YM05FM1
SY0AAB20YN10FM1 SY0AAB24YJ09FM1 SY0AAB25YE12FM1
SY0AAB27YH01FM1 SY0AAB33YA13FM1 SY0AAB33YI22FM1
SY0AAB44YJ04FM1 SY0AAB49YM11FM1 SY0AAB4YC10FM1
SY0AAB50YE21FM1 SY0AAB56YI19FM1 SY0AAB58YP21FM1
SY0AAB59YE24FM1 SY0AAB5YC16FM1 SY0AAB61YC08FM1
SY0AAC13YC04FM1 SY0AAC15YN17FM1 SY0AAC16YG21FM1
SY0AAC19YI10FM1 SY0AAC1YF08FM1 SY0AAC20YN15FM1
SY0AAC21YI23FM1 SY0AAC21YI23RM1 SY0AAC21YJ02FM1
SY0AAC22YE06FM1 SY0AAC24YE13FM1 SY0AAC25YB03FM1
SY0AAC25YK10FM1 SY0AAC25YK10RM1 SY0AAC25YN24FM1
SY0AAC27YE11FM1 SY0AAC27YI15FM1 SY0AAC29YC07FM1
SY0AAC30YE14FM1 SY0AAC30YI20FM1 SY0AAC31YG23FM1
SY0AAC31YL23FM1 SY0AAC31YN23FM1 SY0AAC34YP03FM1
SY0AAC37YG24FM1 SY0AAC37YO21FM1 SY0AAC38YF24FM1
SY0AAC38YK23FM1 SY0AAC3YO18FM1 SY0AAC40YP11FM1
SY0AAC42YH19FM1 SY0AAC42YI13FM1 SY0AAC42YJ13FM1
SY0AAC43YD05FM1 SY0AAC48YE08FM1 SY0AAC49YN12FM1
SY0AAC50YL10FM1 SY0AAC51YH17FM1 SY0AAC51YJ05FM1
SY0AAC52YJ05FM1 SY0AAC53YJ05FM1 SY0AAC55YK16FM3
SY0AAC56YH19FM1 SY0AAC57YK20FM1 SY0AAC58YG13FM1
SY0AAC59YO17FM1 SY0AAC5YE01FM1 SY0AAC5YM05FM1
SY0AAC60YP10FM1 SY0AAC62YJ11FM1 SY0AAC6YJ07FM1
SY0AAC9YO24FM1 SY0AAD19YG21FM1 SY0AAD19YO22FM1
SY0AAD22YM07FM1 SY0AAD22YM18FM1 SY0AAD28YI19FM1
SY0AAD33YB22FM1 SY0AAD33YP23FM1 SY0AAD34YL06FM1
SY0AAD38YK12FM1 SY0AAD40YM01FM1 SY0AAD41YE17FM1
SY0AAD41YH21FM1 SY0AAD42YN08FM1 SY0AAD42YP18FM1
SY0AAD45YE18FM1 SY0AAD47YJ11FM1 SY0AAD49YM19FM1
SY0AAD50YB18FM1 SY0AAD51YN16FM1 SY0AAD5YK05FM1
SY0AAD61YF03FM1 SY0AAD63YB03FM1 SY0AAD63YD15FM1
SY0AAD9YB10FM1