Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3976
Length(NT) : 1157
Best Gene Model Blast : Link to GSTUMT00005652001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: nuclear migration protein NudF
Accession: ref|XP_751175.1| Score: 451 E_value: 5e-50
KEGG Definition: nuclear migration protein NudF
Accession: afm:AFUA_6G12970 Score: 451 E_value: 3e-50
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG0295 Score: 276 E_value: 4e-25
PFAM Definition: WD40, WD domain, G-beta repeat..
Pfam Number: pfam00400 Score: 135 E_value: 8e-09
Swissprot: Q4WLM7|NUDF_ASPFU

Sequence:
>Contig3976
TTGGACCTGGCGACAATTGCCGGACTTAAAAAGCCACCCCCGGCAACATC
GTCTTCAGAATTTATAGCCACCGGGTCTCGCGATAAGACGATCAAGCTGT
GGGACGCGCGGGGCACGCTCCTGAAAACGCTTGTTGGACACGATAACTGG
ATCCGGGCGTTAGCTTTCCATCCGGCTGGGAAGTACCTTCTCTCGGTCAG
CGACGACAAGACCATCCGGTGCTGGGACTTGACACAGGACGGTCGATGTG
TGAAAACGGTCGATGAAGCCCATTCCCATTTTGCAACCTGTCTTCGATGG
GCACCAGCGCCTGGCCAAGGAGCAGACAAATGGAGAGGCAAAAACAAACG
GAATTCCAAAGGCGGGAGAAAAGGTTATCAATGTCCGTTGCGTGATAGCT
ACGGGGAGCGCGGACATGAACGTTCGGGTATTTGCTTCGTGATTCATGGA
GTTGGTTTGGGCTGAATGCGGGCGTCAAAAGCAGGCGGAAGGGATGTCTG
ATTACAGCTCCACTGTTTTTTTCTTGTTTTTCTTTCTTTCTTAACCGCAA
CCTAGTCCTTCTTTCTTGTTACGGAGTTTACCCATGAATAGTTTCCTTTG
TATCATCTTTCACCTCTCTCCCCCCGAGCATTGCTTCGGTCTGCTCTTCA
TACCTTTTGTGGTAGCTACCCTAAATTCCTCCCCTTCTCTCTTGCTCCCT
GCATATCATTGTGTTTTTCCCGGTGGCAATGCCATGTAGATTCGGGCATA
ATTATCCATAGTTTAGTCTCCAGTGCTGTATTTCTTCCCTACCTAATTAT
CTTACTCAGGAGTTTTTTTTCTTTTTCTTTTTCTTTTTTCTGTAGATGGA
TTTATAAGGTATTTTCCTTACATCATACCCGTACCATTTACCCTTTCCCT
TTCCACCCTCATCCTCATCTCCTGAGGTGCGATGGCGATGCGGTATGGTA
GTCTATTTTTTTATTTTATTTTTTTCCTATTTATTCTGCCGCGTGGTCGT
GCTTTTATTTTCTTCTCTTTCATATCTCAAGGAAAAAAAAGGAAAAAAAA
TAGGTCAAAACGGTATGGTATTATACCTTATGGGAACGAATGGACGGACA
GATTAGACTCTTTAAGCCTGCCAACTTAAAAACAATCTCATACTGTATCA
TTATTAT

Sequences in the Contig:

SY0AAC20YN10FM1 SY0AAC20YN10RM1 SY0AAD27YE11FM1