Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3975
Length(NT) : 680
Best Gene Model Blast : Link to GSTUMT00003865001 E-value : 1e-121
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein CIMG_06562
Accession: ref|XP_001242666.1| Score: 702 E_value: 2e-72
KEGG Definition: nucleoside diphosphate kinase [EC:2.7.4.6]; K00940 nucleoside-diphosphate kinase
Accession: mgr:MGG_08622 Score: 683 E_value: 2e-70
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG0888 Score: 549 E_value: 4e-57
PFAM Definition: NDK, Nucleoside diphosphate kinase..
Pfam Number: pfam00334 Score: 604 E_value: 1e-63
Swissprot: Q7Z8P9|NDK_ASPFU

Sequence:
>Contig3975
TTGGCCCATTGCTGCGAACCTCATCCTCACGTTTTCACGAACTTAATTTT
TCCCCATTAATTCGTAACAATGACTTCTGAGCAAACTTTCATTGCCATCA
AGCCTGATGGCGTCCAGCGTGGGCTTGTTGGTCCCATCGTCTCTCGTTTT
GAGCAGAGGGGATACAAACTTGCTGCCATCAAGCTCGTCACCCCCAGCAA
GGAGCACCTCGAGCAGCACTACGCGGACCTTTCTGACAAGCCATTCTTCC
CTGGCTTGATCAATTACATGCTCTCTGGACCTATCTGCGCCATGGTTTGG
GAAGGAAGAGACGCTGTTAAGACTGGACGCGTTCTCCTCGGCGCCACCAA
CCCTTTGGCATCTGCCCCCGGTACCATCCGTGGTGACTACGCTATTGATG
TCGGACGTAACGTCTGCCACGGATCTGACTCGGTTGAGAATGCCCAGAAG
GAGATCGACTTGTGGTTTTCCAAGGAAGATCTTGTGACCTACAAGCAGTC
ACAGCACTCTTGGATCTACGAGAAATAGATATTGTTCCCTCTCATAAGTC
AGGTGTTTGAATACTGGCTCTAGATAGTTTTGCTTCTTCGTTAGTTTAAG
ATACGGGGCATGCTAGATGGAGAATCAGGAGAATGGAATCCCTGAAATAA
AAATAAAATAAAAGAAGTATTTCTATCAAA

Sequences in the Contig:

SY0AAA43YC17FM1 SY0AAA58YK08FM1 SY0AAB13YM01FM1
SY0AAC20YM19FM1 SY0AAC24YL05FM1 SY0AAC59YF01FM1