Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3974
Length(NT) : 484
Best Gene Model Blast : Link to GSTUMT00005797001 E-value : 4e-59
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3974
GGTGAAAGAGATAATTGTCTATTAGAGATAATTTAAGAAATATAAACTGA
CAAGAAGTCTGAATAATTTACAAAATTATAATTACAATACTATTTTGAGT
GATGATAGTATGATTAAGCTGTGAGGTTTGATTAAGCCACAAAATTACAA
TGGTAAGCCACAAAGTCATATTGAGCCGTAAAGTCATGTTGAACTGTCAG
GCACTCTGGAGGAGTGCCCAAGGTTGCGAGAGAGCGAGCAACCATGGGTT
GTGGCTAGCAGCCACAACCTTGGCACGAGTAGTCAAAGCGGACTTAAATT
CCCGAAATCAATGTATCATATCGTCAAATCTTCCAAGGTAGATTTCTCTC
CGGACCCGACGCATTGCCCACCACAGTCGCGCGCTAGTAACCACAAATAA
GGAAGATGAAAAGAAGTAAAAATCATTCGACATATGAAGGAGTGAATAAA
TGAGTGAACCGACCAAGGAAATGGGGTAAAAAGG

Sequences in the Contig:

SY0AAC19YK06RM1 SY0AAC20YM16RM1