Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3971
Length(NT) : 1389
Best Gene Model Blast : Link to GSTUMT00010523001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: hypothetical protein DEHA0A07194g
Accession: ref|XP_456634.1| Score: 433 E_value: 1e-40
KEGG Definition: CaO19.2111; RNA polymerase II transcription initiation factor TFIIF; K03139 transcription initiation factor TFIIF beta subunit
Accession: cal:CaO19_2111 Score: 433 E_value: 6e-41
KOG Definition:
Classification: [Transcription].
Kog Number: KOG2905 Score: 384 E_value: 1e-37
PFAM Definition: TFIIF_beta, Transcription initiation factor IIF, beta subunit. Accurate transcription in vivo requires at least six general transcription initiation factors, in addition to RNA polymerase II. Transcription initiation factor IIF (TFIIF) is a tetramer of two beta subunits associate with two alpha subunits which interacts directly with RNA polymerase II. The beta subunit of TFIIF is required for recruitment of RNA polymerase II onto the promoter..
Pfam Number: pfam02270 Score: 416 E_value: 2e-41
Swissprot: O94424|T2FB_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig3971
TGCTACGACCAACCAACCGCGTCAACTTCATCTCTACTACCCTCACCCAC
CAGCCCTGCAAACAATCTGACGCCGTCACTCACCCCCTCGCCAAACAAAG
GCCATCTCCAACAGATCGCTTCCGCCTACCTTTGTTTCACAGAAGAGCCA
GTTTTTTTGAATGACAATCAAGACGTAGAGGAAGAAAACCTATATCTGTC
TTTCCCCTTTTTTTCCATCGGACACACCTCCGGTGGTCACATACACACAC
AGGCAAACGATGGCGACCAATGGCCCAGCGATCAAGCCCGACCCAGATGT
CAAGATCGAAGACGCAGATATCAAGGCTGAGGTCTTGGATGCTGATGATG
ACGAACTATATGAAGATGCCGGTGACCTGGACATGTCTAAGGGGGACAAG
GCGGTGTGGTTGGTGAAGCTCCCAAGTTTTGTCGCTGAGCGCTGGAACGA
GATTGATGATAATGAGGAGATTGTGTTGGGCGTTGTGAAGGTTAATCCAA
AGGATACTAGCAATCTTAAACTTTCACTTGAGAGGAATCAAGCGAACGGA
GACGAGATCCCTACAGAGTATGATTTGAGGATAACCAATATGGAGGTTAA
CAATACTTTTGTCTTTACGGAGAAAGATATGCCGGGATTTTCGAGCAAGT
TGAATACCGGTGGCGTGAAGGAGGGTGAACCGGCGATTCCTGCGAGGCTG
TTATACCAACACCGTGACCGGGAGAGCAATAGTGGGGGTGGCGGTGGTGG
GAAAGGCAATTGGGGGAAGCAGAGATATCAGCCGTATGTTCGGAAAGCTA
TTCCAAAGAGGACTTCGCTAGTTGGAACAGTTCGCCACGAATGCTCCATG
TCTCCGGTTATCAATGAAGAGTACAAGCGGTTCCAGCTATCTAAATTCCG
TCAAGCAGATGCTCCGAGAGTCACCACCCAAGTTCTCGATCCCAATGCTG
CTGGCGGTAACCTCCTTGCACCCGGTACCACTGGTGCCACAGCTAAGAGT
TTTGCTGGCTTCGTTAAACCCACACAAGCAGTTCGAAAAACAACAGACAA
CAAAGCCGCCCGTATGCCTCACTCAGAACTCCTCACAGCTCTGTTTTCTC
TCTTCGCAGAGCATGAATACTGGTCCATGCGTGGCATTCGCGAGAGGTTA
TTTCAGCCGGAGCAATACCTCAAGCAAACCCTGGACGAGATCGCAAAAAT
GGACCGCAATGGCCCCTTCACAGGAAAGTGGTCACTCAAGAGCGAGTACA
AGAATACAGACGACAAGAAGAAGTTGGAGCTCGCTGCATCCACTGGTGGA
GAAGCCGGCCAGGAGGTCATCGAGATTGACGACGACGATGAAATGGTTGA
GATGGAGGATGTCCTTAAGTAAATTCGGATAGATCGACT

Sequences in the Contig:

SY0AAA23YE18FM1 SY0AAA48YD06FM1 SY0AAB42YF19FM1
SY0AAB56YA09FM1 SY0AAC20YM01FM1 SY0AAC38YM01FM1
SY0AAC41YO13FM1 SY0AAC56YG24FM1 SY0AAC8YO21FM1
SY0AAD23YP23FM1 SY0AAD25YJ16FM1 SY0AAD3YK11FM1