Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3970
Length(NT) : 833
Best Gene Model Blast : Link to GSTUMT00001860001 E-value : 1e-117
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein NCU06977
Accession: ref|XP_962617.1| Score: 327 E_value: 1e-28
KEGG Definition: hypothetical protein
Accession: ncr:NCU06977.1 Score: 327 E_value: 5e-29
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3970
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCAACTTTTTTGTACAAAG
TTGTCCCCGTCGTCCTTTATCTCTCATTCAATAGGTAGCGCTATCAGTTC
TCTTGGAAGGCCTGTGGTTCAAACGAATCTTTGAGAATTCCTTGTAAAAC
TGACCCATAACAACTGCTAGGAACCTGCACACATCGAGCTATCTTGAGCT
AAGTTAGACGAAATGGCTTTCTCCAACCCGTTCTCTCGTGACATCGAGGG
CACTAGCCGGAACATTCCTGCCTACCGTGCCTTCACTATCATCTCGTGGC
TCCTCTTCTTTGTGGTAGCTATCGTTTATAGCATCTCTCCTCCGCACGAT
GGTCATTGGGCCACTGGGACCATCTTCGTAAGTATTTGTATCCCTTTCCC
GCTTTTTGGAGTTATATCCAGTCGGTGAAAAATCCAATGCCTTTTAGGGT
ATAAGCAAAGCACATATCACACCTTTCACACTCAGCCATGCATTCGTTGC
CATTTACTGGGTCTTCCTGTTCTGCAGCCAGATCAGCTTCGTTGCACAAT
TGTTTAATTAGGGAGGGATGAGGCCGCTGTAACAGCTGCTGCTTCTGTTG
GAAGCCATTTCATTCTTTTTAACCTTTTGCAATTTGGTTGGATTATGCTC
TGGACTCGCTCTCTATTCTTCTGGAGTGAGTTGTTCGCCGCTTTAAACTT
TTTGCAGCTGGTCTTGTTATACCTTCGCAACCCTACCACACCAAGACTCG
TTCACGTTCCGGCTGCCGCCATGCCTTTGACGTGGTCATTCTTCCTTGTT
TTTTGGAACGGGTCTGTCATGGTTGGATGCCAT

Sequences in the Contig:

SY0AAC20YL24FM1 SY0AAC23YK16FM1 SY0AAC57YM09FM1