Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig397
Length(NT) : 1949
Best Gene Model Blast : Link to GSTUMT00003711001 E-value : 0.0
Numbers of ESTs : 12

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001543000.1| Score: 209 E_value: 2e-14
KEGG Definition: predicted protein
Accession: aor:AO090120000311 Score: 174 E_value: 9e-11
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 146 E_value: 7e-10
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 134 E_value: 2e-08

Sequence:
>Contig397
TTGGCCATCTCCCCATCTCCCCGTTTCTGACTCCTCAACCTTTTCCGCTT
CCTTCTATCACCCCTTCCCCGGGCCACTCAATGTGGAGTGATTGAAAACC
AATAAAATTTTCTCTTCATTCTCAAAATTTCCCTCTCTTCCATTCTTCTC
CTCCCCTCTTCCTCATCCCCCCATTTCCCCTTCTTCGACTCTTTAACCTT
TTTCACTTCCTCCTATCACCCCTTTTCGGGGGCCACTTCCACCAAAACCC
ACGCCAGCACCACCGGTGCCCCGTCCCTGCATCATAGCCCGGTACTCTAA
GTACTATTTATCGAGCCACCGTCGCAACCCAACGCTAGTCTTGACGAATT
TGTCGACGCATCTGTTAGGCCTCACTCCAAAGTCTTTGCCTTGTGATCGC
CATACTTTGTTGTCTCCTCTCGCGTTCCTATCATCTCTGGATTTCCTTGC
TCCAGCCCCGCTGTTGAGGAGTTACGACCTTCACAAATAACAGTTTCCGA
GTCCCCAACCTTCCGATCCATCAATCAGCAACCGAACTACGATCATGGCC
CCCACGAGGAGGCAGCGCCTTCAGACTGAGTGCGGGGATCTTGGACTTCC
TACTACGGGGTCAGTCGCACAGCTAATCAAGCGTATCAGAAAACATAAGG
AATCCCGGGAGACCCCGATGTCAGACGAAGAGGATCCAGAATCTATGGAT
GAAGAGGATCTAGAATCTATGGATGAAGAGGATCTAGAATCTATGGATGA
AGAGGATCCAATGTGTGATGCTATACTCGTCACACAATCAATGTTTGGCG
GAGATGACTACATGAAGATGCAAGCTAAAGTAGCGTTCGAGGAGGAATTA
AAAAAGGAGCAACTGGAAGTTGAACATGTGAGAGGAGAAGTTTATGTCGG
AAATCGCCGCGGGCTTGATCTCGCCGGTACGAAGGCCAAGCTCAGTGCGC
ATGAAAGCGAGATCTGTTTTCTTAAAACCCGTGTCCAGGACCTCACAACC
AATGCCGAGGACCTCAAAAACAATGCCGAGGACCTCAAAAACAATGTCAA
AGCTCTGACAGCCCGCGTGTCCCTATTGTCGATTGCCGCAAAAGACTATA
AACGGGTGCGGCAGAGATACATTAGCACCTTCAAGCGAGATCATCTACCG
GACATGATGGAGCAATCGGACTACGACATTATCCGAACTGTTAACCAAAC
CGTGCATGAGGGAGATGTTGTAGTGGACGCCTTCTTGTACGAGGAGGGGG
GGAGGGGCGACACACACACATTCCAGGAACTATACGGATTACACCCGGCC
ATTGTTAGAACTATTGAACACCCGGAAACATTAAACATCCTGAATCTCCA
CGCGCAGGTCCGGGCACATAAACATAAAACAGGGACCGAAGAATTTTTTC
GGAAATTCGCTGCGTTTATCCAAGCATTCGAGAAATCCAGTCTGAACCCG
AACTATTTGACCAGCGAGCCCCGGAACGCAACTTGTATCGCATATTGGGC
ATTACATAATTGCCCAAAATACAAGGACGGTGGGGGGTAGCGTTGCGATG
TGGGCGTCCTACGAGGGAGATGGTGGTGGTGTTTTGTGTTGTGCTGGCGG
TGGGGTCCGGTAGGGGCTGGGGGCGTGGGTGGAGATGGTGGTGTTGTTTT
GTGTTGTGCTGGCGGTGGGGTCCGGCGGGGGCGGGGGCACAGGTGGGGAT
GGTCGTGTTGTTTTGTGTTGTACTAGCGGTGGGGTCTGGTAGGGGCTGGG
GGCGCAGGTGGAGATGGTGTTTTTTTGTGTCGTGCTGGTGGTAGGATCTG
GCGGGGGCGGGGGCGTGGGTGGGGACGTGGTGTTGTTTTATTTCTTGCTG
GCGGTGGGGGTCCGGCTGGGCATTCTGGGAGTTTTCCGCACAGGGCCTAC
TTGGTTTCATGGGTTTTTTCCATGGATTGCGCCTGCTGTAACATAAAAT

Sequences in the Contig:

SY0AAA22YN20FM1 SY0AAB16YK23FM1 SY0AAB17YC10FM1
SY0AAB24YI10FM1 SY0AAB56YP23FM1 SY0AAB61YM04FM1
SY0AAC45YB07FM1 SY0AAC9YC11FM1 SY0AAD41YM11FM1
SY0AAD48YI05FM1 SY0AAD61YE23FM1 SY0AAD63YM21FM1