Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3969
Length(NT) : 2097
Best Gene Model Blast : Link to GSTUMT00005031001 E-value : 1e-137
Numbers of ESTs : 9

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3969
TTGGGGAATGAGGTCTTCACAACGGGAGGTACCGTCGAAAAACGCCTGGT
ATCGATCCACGCTTTGTATTCTTGGAATAAAGGGCAAGAGGGGTCTAGAA
AGGATGAAGCGAGTGCCTGCAGTGTGCAGTGCATGTATGATACCGGTATA
TCCCCTACTGAAGAGGGCGCCGTGCCGGTATTGCGCCCTGAATACTGCGG
TGCGGGTGGAATTATTGGAGTTGTCTCTTAGACGTTGCCAGAGAGCGTTC
AGGGCCTGTTCCTTCTTTCTTTCTTCGCATCATCGTCACCCACTGCCGCC
GAGGTGCACAAGTGTACGAGTATCATACCGGCTGGTTCTCCAAAACTGCA
CGTGAGGGTAGGGCATCGGAGCGCGTATTATTAGACTATTTTTACTCGAG
TAGAGTGGTTTGTTCAGATCTCGATTTTCGGAGCCTCTGGGATATTTTTC
CTTTTCCCCCTCTCTTACATACGCGCTCCCCGCACACATTTTTCTTCATT
TTGGAGGGTCTTGTCTGTGTTTGCATGTGCCTGCTGTCCTGTTCTATCTA
GCGTGTGGGTGGGTGTTCGGATTGGACGTTCGACGGATCAACGTTCCCCC
TTGTTACTCAATTGCTCCAGCCCTTTTGACAATCCGGGGGGGTGCGAGAG
GTTTCCATATCGATTTATACATTGCTCATTTGGGGGGGGGAGTGAATTTT
TATTGTCTTACAGACCCAAAGAACATTTATAGGGCGAATCCGGCTGACTT
CCTAGTGTCCACCCCCGCCTGGACATCTGGTCTATCTCATTTGGGAAGAT
ATTGGCTCGCAAAAGTGCAGAGGATTAGAGAGAAACTATTCCTCATCAAG
AGCAATACTCGTACTGTACGCCTCTCCGCTCTCCGCTCCTGGTTATCGAC
TTTGCCCTTCTCGTGCCAACTTGGCATAGGCCAATTTTTGGTCTGATGTT
GTGCTTCCCCCGATAGCCATTTTTGCCCTCCCGGCTCCCCGCAGAAATCC
ATGGGATCAGAGTAACAGGTTCCTTTTTATGGAGTCACTCATTCTCAGCC
GTCCTTCTCAACGAGGCTCGTAGCGGATGAATAACTAGCCACGTGGGTCA
TTATATTTACTTGTTTGTGATCCTACACCCAATCGTTGTCCGTCTTCCCC
CGCGCCCTTCCCCGCAATATACTACGGAATTTTATAGAACGAGTCTCCTG
GTCAGTCGTGAGAGACAGCTAGCAGGGGGGAGGGAGTTTAATAGTTCCTA
GTTTATTGAAAAATAAATTAATCACGGAGGGACCACACTATCTTCTTCCG
CCTCTCTCCTTCAACCTATATTTTGGCATTTTTTTGTTTTTATCTTGTCA
TCTCTAAAGCTTACTTTTGGTTCACCCCGCAAAACTGATAAGGAACCCTC
TCCCAGAAAGGACCGTCTGAATAGATTTGGTTTGTTTCAACTGCTCTGGA
CGGAAAGGGTGCGGATAGCATTACATTGGGTCCATACCCTGCTGTTACCT
GGATTCAGTTTCCTAGTGTGCTCTCTAACCCTCGAATACACGCCAGCGCA
TCCCTCTGCTTGGTCCGCCGTATCGCTGTAAACCAATTCGCCCCAGATCT
CGCAGGCCAAACCAAAATTTCCGTGTCGGTTTCCTACTTTGAGGTCTTAT
CCCGCCATTTCACCTTATTTTACCTCTACTGGGGGATTACCATATAGCAC
TTGTTATAATTGAAGGCTGGAGGGGAGGAGGGTGTGCCTCTGGGCAATTC
TGGCCTCCTACTCTTGCGTAGCGCTTCAGCATACCTGCTTGTCTGTGGCT
TTGGGGGCAGTTGAGTGCCAGAAATATTGGCAGGAGTGGGATAGTATCTG
GAGTGCTATCTCTAGACTATTGAAATTTTGTCATTTTACCCACCCTAGAA
CCAAGTTGAGAGTGCATGTCTTTCGGGGATCCTTTTTCTTTTATTTTCAC
ACTCCATCCACACCCTTCATTAGAATCTTAGTATCTTAGAAGGCCCGGGG
GTTTCCAGAGGATCATCCGCTTGAGCACGATCCTGTTTAAGCCCCGGAGA
GATTTTGCCTTACACGGAGGAGTCCCGTGTGGGGTAGTGGGCGGACG

Sequences in the Contig:

SY0AAA13YC12FM1 SY0AAA25YN03FM1 SY0AAB56YL03FM1
SY0AAC17YC08FM1 SY0AAC20YL20FM1 SY0AAC42YP12FM1
SY0AAD32YN06FM1 SY0AAD45YN19FM1 SY0AAD8YP15FM1