Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3968
Length(NT) : 976
Best Gene Model Blast : Link to GSTUMT00005421001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_01690
Accession: ref|XP_001559534.1| Score: 291 E_value: 2e-24
KEGG Definition: hypothetical protein
Accession: ani:AN7650.2 Score: 261 E_value: 3e-21
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 113 E_value: 2e-06
PFAM Definition: Herpes_BLLF1, Herpes virus major outer envelope glycoprotein (BLLF1). This family consists of the BLLF1 viral late glycoprotein, also termed gp350/220. It is the most abundantly expressed glycoprotein in the viral envelope of the Herpesviruses and is the major antigen responsible for stimulating the production of neutralising antibodies in vivo..
Pfam Number: pfam05109 Score: 119 E_value: 4e-07

Sequence:
>Contig3968
TTGGCAACCACGATATGGCACCTGGCGAATACAAGCTGTCCCAGGAGGTC
TTAGTATTTCTTATCACTCACCAGGACCACTTCTTACTCGGGATGCGGGG
AAGCGAGGATCAAAATCAGGCTAGCCTAGTTGGGCCAATTACCCCCTCAT
CTCCAAGACGTTCAAAGACAGTGGTCAGTAGGTCGCCTTCAAATGCTAGT
GCTGGGGCGGACGATGTGAGAAAATACGGCGGGGTACGCAGAAATGTCTC
AGTTACATCCCGAAGGTCTAGTGGTAGTCCAGTTGTAAGCAGCGTTGGGG
TAGCGGGGGGAGGGGTTAATGGTAGTGGCTTGAACCGGAGTAACACTCTT
CCCTCAAAGCGATCTCCCGCTGTGCGACCGGCGGCCTTTGCACCAGGAGA
CGTTTCGCCGAGCCCTAATTCCCCGCACACTCTGGCGCCCACGTCGAACA
TCACGAGGTCGCCCTCTATCGGTGGACAGATGCGCGAAAATGTTGGTCCT
ACTTCTCCGGACATCGCTTTAGCTGAACCAAAACGTGAAGCTTCAAGCAC
GTCTCCGCCTAGGACTGAGGTCCCTAGACAGGCTCCCAGAGAGCCCCCCA
GAGAGCTCCCTGGAGAGAGTCTGGAGAGTCCCCAGGCACAGCCACAACCG
GTCGTAACACCCACAAAGGAAAGGACATTTCAGAATTTTTTCTCATTATC
CCCCGAGGGCGATAGGCCTGGCAGGCCCCCCAACAAGCTAAAAAAAAGGC
GAATCCCAGGAAGCGGCGGCAATTCCGCTGAGTCTTCAACAACATCCTTA
TCAGGTGTCGGTGGTGGACCGAATCCTAATGGGCCTGCTCCGACCTCCCA
TGGGGCGCTTGAGCCTAGTAAACTATTGTTTCCTCGCCCACAATCACCAC
CCCCACGCTCGCCGAATATCGACATAGCTTTACCTTCGAGTTCCCAAACC
AATCATGCCTCTGCAGGCAATCCACC

Sequences in the Contig:

SY0AAA55YM22FM1 SY0AAC20YL19FM1