Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3965
Length(NT) : 790
Best Gene Model Blast : Link to GSTUMT00005832001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_02372
Accession: ref|XP_001596156.1| Score: 565 E_value: 2e-56
KEGG Definition: hypothetical protein
Accession: ang:An18g03130 Score: 522 E_value: 1e-51
KOG Definition:
Classification: [Cell cycle control, cell division, chromosome partitioning].
Kog Number: KOG0822 Score: 424 E_value: 1e-42
PFAM Definition: PRMT5, PRMT5 arginine-N-methyltransferase. The human homologue of yeast Skb1 (Shk1 kinase-binding protein 1) is PRMT5, an arginine-N-methyltransferase. These proteins appear to be key mitotic regulators. They play a role in Jak signalling in higher eukaryotes..
Pfam Number: pfam05185 Score: 478 E_value: 8e-49
Swissprot: P78963|SKB1_SCHPO
Gene Ontology:
GO:0005938 = Cellular component: cell cortex
GO:0051286 = Cellular component: cell tip
GO:0005634 = Cellular component: nucleus
GO:0005515 = Molecular function: protein binding
GO:0007163 = Biological process: establishment and/or maintenance of cell polarity
GO:0035246 = Biological process: peptidyl-arginine N-methylation
GO:0008104 = Biological process: protein localization
GO:0007346 = Biological process: regulation of mitotic cell cycle
GO:0047484 = Biological process: regulation of response to osmotic stress
GO:0009826 = Biological process: unidimensional cell growth

Sequence:
>Contig3965
CAAAGCAAAAGAACATTATCGATGCATTGGTATATTTGCCACGAAAAAAG
ATGAAATTCAGGCAGAACCAAAGCAGGGTAGAGTACTAATCTACATCAAA
CAGCCATTCTGTTTACTGGAGTGAAGGTCAGTAGCTCCAAGGCGGTATCT
ATGGCCCCCGTTGCGAGTAAAGGCCTCAGCAACCCATTCGTACCACACCT
TGCGTTCACTGGTCTGTCGCCAGATGCAAACGTCAAGTTCGCAATTGTCT
GGAAGGTGTAGCGGAGTCTTAAACGGGAAAAAGATTGGGAACCAACTGAT
CATATCCTTGGACTTCATGTCAATTGTGTCCGGTCTCGTGCTAAGCTCCA
CATCGCCGTACAACACGCTCTCAAAGTACCCCGCAAGCCCATGCATGACC
CCCCTCCTGGGCACTTTAAACGTGGCCTTGCACTTTCTGGCGTTGTGATC
ATTTCCCCCATCGCCGAGCCCGATTAGACCCCCACCAAGGGCAGCGGAAT
CGCTTAGCACGTTGGGCGGTAGAGGGTGTGTGAATTCCCAGGCTCGGTGA
ATGTGCTCCTGTTCAGCGAGTATCTCAAATGATTGCAACATGACGACGTA
CGGCGTCTCGGCCGCGTCGGAATCGTTCTTCCGCGAGGATATGTCAGCAT
GGATTTTAGGCGCCATGATTGGTGTAAAATGGGCTGAATATGAGACAGGG
ATTGAGATTCCTCCAGATGGGTTTAAAACTCTCCAACTTTTTTGTACAAA
GTTGTCCCCCCAACTTTTTTGTACAAAGTTGTCCCCCCAA

Sequences in the Contig:

SY0AAB44YD05FM1 SY0AAC20YK17RM1