Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3964
Length(NT) : 726
Best Gene Model Blast : Link to GSTUMT00004987001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein CIMG_04691
Accession: ref|XP_001245250.1| Score: 740 E_value: 1e-76
KEGG Definition: predicted protein
Accession: aor:AO090701000325 Score: 712 E_value: 9e-74
KOG Definition: No Hit Found
PFAM Definition: Chromate_transp, Chromate transporter. Members of this family probably act as chromate transporters. Members of this family are found in both bacteria and archaebacteria. The proteins are composed of one or two copies of this region. The alignment contains two conserved motifs, FGG and PGP..
Pfam Number: pfam02417 Score: 251 E_value: 1e-22
Swissprot: P14285|CHRA_PSEAE
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>Contig3964
TTGGACCCAGTAAATCAACGTTTAATTAGCTCTCCTCTTCATCGCCCGAG
CACGCGAAACTCCAGACATGCCTTTGTCAGCAATATTCAGGTCGCTACAG
AGCAATCAACCAGATGCCTACCAGGCCATGAAGGGGGGCCTAGGCCTTCG
GCTGTGGGAAATTGTCGCGAATTATTGGGATTTGGGGTTTACTTCTTTCG
GTGGCCCTCCAGTGCATTTTCAGATCCTGCGCAAGAGGTTTGTGGATGCC
GAGAATGGGAGGATTCCTTGGATCGATGATCAAACCTACCAAGAGCTGTT
TGCCATCTGCCAGGCACTCCCCGGACCGGCGAGCACAAAATTTGCCTTTT
GTATCGCTTTGATACACGCTGGGTTTATTCCAGCTTTCCTCGCATTCCTT
ATCTGGAGTCTTCCGGGTGCAATTGGGATGTTTGCTCTGGCGCTCGGGGT
TGAGAGAATAGGCGAGGTCCTTCCTGACCCAGTTTATGGCTTGCTCTCTG
GTCTCAATGCCAGCACCGTCGGCATTATCGCTCTGGCGGCCGTCCAACTC
GCCGAGAAAGCTATCACAGATCCTCTCACTCGTATGCTTGTCATACTAGG
AGCTTGTGCTGGGCTTCCATATAACGCACTATGGTACTTTCCGCTACTGA
TGGCCATCGGAGGTATAATCACAATCTTCTGGGACCTTTGGGGACGTGCC
AAGTTTGGCCGTATGAGGGCTCGGTT

Sequences in the Contig:

SY0AAA39YK05FM1 SY0AAA50YE10FM1 SY0AAB32YG18FM1
SY0AAC20YK15FM1 SY0AAC38YF15FM1 SY0AAC47YF10FM1
SY0AAD11YB03FM1