Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3963
Length(NT) : 863
Best Gene Model Blast : Link to GSTUMT00009360001 E-value : 1e-79
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3963
CCAGGTATGATAGTCTAGATAGACTGAATGATCTTCGGGTACAGTACAGT
ACACAAGATGAGATATTATTATATAACCCCCGACAAACAACCACCTTCAA
TTACCCAATCCTGCCGAATTCGCACAGTAACTATGGTACTGTAGTGGCAG
CTACTTCGATAATGCACCGTCGAGTCCATGTTCTGGCACAGTGCACCACG
ACAGCAGCGCTCATCTACAAGTGCAGTGCCGTAAATGCGGCTGGTTGGCA
TTCCACGGGAGTGGGAATAGACCATGCATGGCGCGGGTGTGGGTGTGTGG
AAACGGTAAGGTGAAGGTATGGTATCGATTATTTCAAGTGGTTATGGCGA
TACTGTGCAATCGGGGCTCCCATTGATTCATCGGTATGATACTTGCAATG
ATGTGATACCTATACGGGAGTCTGACCGATTTATCATACTCACATGTCGA
GTATTTGAAAGGCGACTTGCCACTGAATACCTAACATTCCCGCAGTCATA
GACCATCTCCATAAATTTGAAAGAAAAGAATAGGAAAGAAGAGGAAAAAA
GACAGTTGATAATATTATGATAGGCAGACCTTGCAATTTGATTGACAAAT
GAACCTCCTCCCCCTCCTCAAGTGTTCGATTTTAGTTTCTCTCCCGGTAT
GATACCCCAACTCGCCCACATTGCATAATTGCTTCACGTCCCAAGATTGA
AAACATCATTCCTCCACCCTCCCTCCTCGCCAAGGGCTACAACCCTCTCA
GTGGAGTCCTTAATCTTGCCAACAATCCCACCCGGCGGGAATTCGCCGGG
GAATATATCGTCCTCCCCGATATTAACCCTGTCCAACTTTTTTGTACAAA
GTTGTCCCCCCAA

Sequences in the Contig:

SY0AAC20YK11FM1 SY0AAC20YK11RM1