Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3962
Length(NT) : 667
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein DEHA0E06589g
Accession: ref|XP_459575.1| Score: 1026 E_value: 1e-110
KEGG Definition: hypothetical protein; K04077 chaperonin GroEL
Accession: dha:DEHA0E06589g Score: 1026 E_value: 1e-110
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0356 Score: 843 E_value: 3e-91
PFAM Definition: Cpn60_TCP1, TCP-1/cpn60 chaperonin family. This family includes members from the HSP60 chaperone family and the TCP-1 (T-complex protein) family..
Pfam Number: pfam00118 Score: 447 E_value: 3e-45
Swissprot: O74261|HSP60_CANAL

Sequence:
>Contig3962
TTGGATCATCTCGTCAAGTTTCTAAAACTACTTTATCTCTTGTCCGTAAT
TATTCTCATAAGGAATTAAAATTCGGAGTTGAAGGTAGAGCTGCACTTTT
AAAAGGTGTAAATACTTTAGCTGATGCAGTTTCAGTTACTTTAGGTCCAA
AGGGTAGAAATGTCTTAATTGAACAACAATTTGGTTCTCCAAAGATTACC
AAAGATGGTGTTACCGTTGCAAGATCAATCACTTTACAAGATAAATTTGA
AGATATGGGTGCTAAATTATTACAAGAAGTTGCTTCAAAGACTAATGAAT
CAGCTGGTGATGGTACTACATCTGCTACAGTTTTAGGTAGATCAATTTTC
ACTGAATCTGTTAAAAACGTTGCCGCTGGTTGTAATCCAATGGATTTAAG
AAGAGGTTCTCAAGCTGCTGTTGAAGCTGTTGTTGAATTTTTACAACAAA
ATAAAAAGGAAATTACAACTTCTGAAGAAATTGCTCAAGTTGCAACAATT
TCTGCTAATGGTGATAAACATATTGGTGATTTATTAGCTTCAGCAATGGA
AAAAGTTGGTAAAGAAGGTGTTATTACTGTTAAAGAAGGTAAAACTTTAG
AAGATGAATTAGAAGTTACTGAAGGTATGAAATTTGATAGAGGTTTCATT
TCTCCTTATTTTATTAC

Sequences in the Contig:

SY0AAC20YK01FM1 SY0AAC21YA14FM1