Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3961
Length(NT) : 1031
Best Gene Model Blast : Link to GSTUMT00012121001 E-value : 4e-95
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3961
TTGGCATTCACGAACACATCTTCACTTTGTCGAATCGGGGTGTTAGTTTT
GTTGCTGCCTTTACGGTGACATTTGGTGTGTGTATTTGCAGCCCTCACAG
TTCGTTCATTGCCTTGCTTCCCCGCACCGCACGGGGTCAGCAGAACTGCC
TGTGTACCTCCTTCCAGGTACCGTCCCCAGCCTGCCGCGCTTCAAGATCT
CCGGCAGGCATCAGAGTACCCTCCTCCGAAACCTTCTCCCAAAAGCTACA
ACGCCCCGAACCCATTTTTCCCATTTTTCCCTTTCCATCTTCGCTTCATC
GGACTTATCATACCAGTAAAATAAAACGGCCGAGGGCTGAGCTATCTCTG
TTGTGTTACAGCAGCGAGAGGAAAAAAGGGAAAAAAGAAAGAAAAAGAAG
GGAAAAAAAAGAAAAGGCTCTTTTCTCCCTCGTGCTGCTAAACTACGCCT
GCCTGGCTAGGTTTTGCTGGTCCCGCACCGCACCGGTCATCCGAGCCTCA
CCCGTTGCGAGACCGTCTTTTCTTCGTCGACTGAGCTCTCTTCCTTCCAC
AAGTGCTGTCCGATTGCGCATTATCCATAGCGTTGAAGGGGTACCGGTAC
AGTGTTCTGCGCTATTATCTTGCATGCTTGGTAACGCGCCTACGAGACAT
TCATCACGGTGTGCGTATACAGCCCGCCCCCATTCATCCCCCTCCATCTA
TTGTCGTTGATCTTTAGTCTACAGTCCCTCCTCCCTCTTCCCACAGTCAT
CCGCACACGGGCCGCCCGCTGTTTTACCCGCCCATACCCCGTCGCCACGG
CGTCCATAGTTCATCTCTTCGACCATCTTTCTCTCCAAGTCCATCGCGCT
TGGGCCATGGACGAAATGGAGATCGCTTCGTCTGCTTCTTCCCGCGGGCC
CGAGATCCTCTCCAATCCCGTGATCATTGAATCCATTCTTCCGGCCCTTG
AGCATATGAATGATATACTCTCCCTTTTACTTGTTTCTCGCCAAACCTAC
CTGCTTGTCAACCCCCTGCATCCGTTTTCTG

Sequences in the Contig:

SY0AAB41YM20FM1 SY0AAC20YJ16FM1 SY0AAC30YA12FM1
SY0AAC36YD13FM1