Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig396
Length(NT) : 737
Best Gene Model Blast : Link to GSTUMT00005691001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: mitochondrial inner membrane AAA protease Yta12, putative
Accession: ref|XP_001272939.1| Score: 1137 E_value: 1e-122
KEGG Definition: AAA+-type ATPase containing the peptidase M41 domain [EC:3.4.24.-]; K08956 AFG3 family protein
Accession: aor:AO090026000613 Score: 1136 E_value: 1e-123
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0731 Score: 1016 E_value: 1e-111
PFAM Definition: AAA, ATPase family associated with various cellular activities (AAA). AAA family proteins often perform chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes..
Pfam Number: pfam00004 Score: 563 E_value: 1e-58
Swissprot: Q9HGM3|RCA1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig396
TTGGCCAAGATCCCACGCGGTGCAATCCTCTCTGGGCCTCCCGGTACTGG
TAAAACACTCCTTGCGAAGGCTACTGCCGGGGAAGCCCAGGTCCCTTTCT
TCTCAGTGAGCGGTTCTGAATTTGTGGAAATGTTCGTCGGTGTCGGCCCC
TCCCGTGTACGAGATCTCTTTGCCAAAGCCCGGAAGAATGCGCCGTGTAT
CATCTTCGTTGATGAAATTGATGCTATCGGAAAGTCACGTGCCAGGGCAA
ATATCGGAGGCGGTAACGATGAGCGAGAGAGCACACTGAATCAATTGCTT
ACCGAAATGGACGGTTTCAATACTACGGAGCAGGTGGTTGTTTTAGCTGG
TACCAACAGAGCAGACGTTCTTGATAGAGCACTTATGAGACCTGGGAGAT
TTGATAGACACATCACAATTGATAGACCAACCATGGATGGGAGGAAGCAA
ATATTTTTGGTCCATCTTAAGAAGATTGTAACCTCTGAGGATATGGATTA
CTTGAGTGGGCGTTTGGCCGCATTGACTCCTGGTTTCTCTGGAGCTGACA
TCGCGAACTGTGTTAATGAAGCTGCTCTCATTGCCGCGCGGGGCAACGCC
GACCAGGTTTTAATGACCCATTTCGAGCAAGCAATTGAGCGTGTCATTGG
TGGTCTCGAAAAAAAATCCCTTGTCCTCTCACCAGAGGAGAAGAGAACGG
TTGCGTATCACGAGGCCGGTCATGCTGTTTGCGGTTG

Sequences in the Contig:

SY0AAA22YN19FM1 SY0AAA52YL10FM1 SY0AAB20YO22FM1
SY0AAB39YA15FM1 SY0AAC38YK02FM1