Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3959
Length(NT) : 1484
Best Gene Model Blast : Link to GSTUMT00005364001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_09461
Accession: ref|XP_001589739.1| Score: 871 E_value: 1e-168
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG09432.1 Score: 853 E_value: 1e-165
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1498 Score: 829 E_value: 3e-89
PFAM Definition: PCI, PCI domain. This domain has also been called the PINT motif (Proteasome, Int-6, Nip-1 and TRIP-15)..
Pfam Number: pfam01399 Score: 206 E_value: 6e-17
Swissprot: Q5RBI3|PSD12_PONPY

Sequence:
>Contig3959
TTGGCCGCCCTATATAATGTCGGACGAACCCGTGCTAAAGGCAGACAAGG
ACTTCACTGAAACACTAGACAGACAGCTTCCGGAGATATTATCACTCACT
AAGACAAACAAAGCAAACCTCCCAGCCGCCATCGAAAAGCTCCTAGCATT
AGAAAAGCAAACGAGACAGGCTAATGATTTGGCTTCTACCAACCGCCTCC
TCACCACGATTGTTTCACTATGCAAGGATGCCGGGGAGTGGAAGCTTATG
AACGAGCATGTCCAAATACTCTCAAAGAAACATGGCCAACTGAAGCAGGC
CACAACTAAGATGGTGCAGACTGTGATGGGTTTCCTTGATGAGACACCTG
ATACCGAGACGAAGCTCTCCGTTATTGAAACGTTGAGGACAGTTACTGAA
GGCAAGATTTTTGTTGAGGTTGAGCGGGCTCGTATAACCCGCATCCTCTG
CCATATCAAGAAGGCCCAGGGTGACCTTGCCGGAGCCACTGATGTTTTGT
GTGAACTTCAAGTCGAAACATTCGGGTCTATGGATCGACGGGAGAAGACA
GAATTTATTCTCGAGCAAGTCGAGTTCTGTATTGAACGTGGAGACTTCAC
CCAGGCGGGAATTCTTTCGCGAAAAATTTCTACAAAATACTTTGCCCAAA
AAGAAGTATCTGATCTGAAATTGAAGTTTTATGATCAGCAAATCCAACTT
GCAAAACAAGAGGATAAATATCTGGATGTGTGCAAACACTATAAGGCAGT
TTACGACACCCCGAGTGTAGTTGAGGACCCTCATAAGTTGAAGAGTAATG
ATAGGTACTCGAGAGGATCATATATTACATTATCCTGGCCCCCTACGATA
ACGAGCAATCAGACCTACTGCATCGCATTCATGCAGATCCGAATCTAAGT
TTGGTTCAAAAACAATCAAATCTTCTCAAATGCTTTACAGTTCATGAGTT
GATGCGCTGGCCTCTTATCGCTGAAAATTACGGGGCCGGGTTACGCACTT
CCGATGTTTTTGCGATTGGTGACCCTAGGGCCGAGAAACGCTGGGATGAC
CTGAGGAAACGTGTTATCGAACACAATGTAAGAGTTGTCGCAAAGTATTA
TACCAGGATCAGGATGGACAGATTAAAGGTTCTCCTCGATCTGGACGAGG
ATGAGGCCGAAACCTATCTAAGCCAGCTGGTAACCCAAAAGACTGTCTAC
GCCAAAATAGATAGACCTGCGAGAATCATCTCCTTTGCTGAGCCCCGAGA
CGCGGACGATGTCCTTAATGAATGGAGTGGCAATATGAAGAGTCTTCTAG
GGCTGTTGGAGAGAATTGACCATCTGATCACAAAGGAGGAAATGATGGCC
AATATCGCCCCAAAGGTTAAGAGCAAAGGAAAGGCTAAATGAGGTGGATG
TAGCTAGATTTGTGTATAATAGACATTGCGGCAATACACGCAAAGTTGCT
AGCTCCTTATTCACACCACATTTCCTCTGCCTGC

Sequences in the Contig:

SY0AAA26YO05FM1 SY0AAB27YC12FM1 SY0AAB38YP03FM1
SY0AAC14YM05FM1 SY0AAC20YJ10FM1 SY0AAC20YJ10RM1