Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig3958
Length(NT) : 895
Best Gene Model Blast : Link to GSTUMT00009779001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein ACLA_065240
Accession: ref|XP_001272316.1| Score: 241 E_value: 1e-18
KEGG Definition: hypothetical protein
Accession: ang:An12g00350 Score: 230 E_value: 1e-17
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig3958
GAGATTCCATGATTTAGCTCCCTTTTTTCCCGCCGCTAACTGGCGACTCC
ATAATGCTGTACGATACTATGCCCAAACCGCCAAACAAACGGTGCCAACC
TGGAAACCGCACCCCCACCCCAACTGGGCATCATAGACACCGTCATGTAA
TTTCCGATTCCCCGCGAGAACCAAACTAACCAGCTAGCTAAAAGTAATCC
GGTTGTGACCAAGAAACGAAGCAAATATTCTCTCCATCCCGCCGCATGAA
TCCTTCTGCCTCCAAGTATCCCATCCACCCATCCACCCATCCACCCGCCT
TCATATATCCAGGTCGGGGGTAAACTAGAGTAAAAAATCTGCCAAAAAAT
ACCAAACACCCCTAAACACCCATACCATAATCCCCTAGAGAGCGAACAAA
AGTGGAAGCAGGAAAAAAGTATTGACAAAAACGGGGGTATAAAGGTAATT
TTACAAAGTGAGAAAGAAGAGAGAGCGCATCTGATAGTTACATGCTATTC
ACCGCATCCGGTTTGCTCCTGATGGGTGCGGGGATAGAGGCGGGTCGCGG
CGTAGTTGATGTGGAGCAAGAGCGTAGGTTACCCCATCGTCAGATGCATA
TGACGGGGGACGGGGAGTTGTCCTGCTGTTTCGATCACTATACCCATGGG
CGGAGGTCGTCGGTGCGCCTGCACTAGTCCTTCTAACCCAGTAGAATTGG
TCCGGGTTCACTCTCACAGAGCATCGCCAAAGCCCATATACTGGTGGTGG
GGACTTGGTAGGATCAGCAAGACCTTGGTCATCTGCGCCATACGGAGTGT
GTATCCGGATCGGCTCCCGTGGGTTTGCATATCCACCTGGTCCAGCTACG
GACGGGATGCGGGTGAAGTTTTGGGAAAGACGTTGGAAACGCCAA

Sequences in the Contig:

SY0AAC20YH17FM1 SY0AAC20YH17RM1